Clone FMO10174 Report

Search the DGRC for FMO10174

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:74
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15065-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10174.5prime Sequence

146 bp (146 high quality bases) assembled on 2010-11-05

> FMO10174.5prime
CAATCGACATGAAGTGGATGTCCTTGGTCTTTCTATGCGGTCTGCTCGCC
ATGGCAGTGGCTTCTCCGTTAAATCCGGGTAATGTCATTATCAATGGAGA
TTGCCGTCATTGTAATGTTCGCGGAGGCGCAAGCTTTCTAGACCAT

FMO10174.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:54:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG15065-RA 218 CG15065-RA 31..150 9..128 600 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:54:37
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18390106..18390174 60..128 345 100 Plus
2R 25286936 2R 18389989..18390040 9..60 260 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:54:37 has no hits.

FMO10174.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:08 Download gff for FMO10174.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15065-RA 25..157 1..136 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:10 Download gff for FMO10174.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15065-RA 24..156 1..136 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:40:29 Download gff for FMO10174.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15065-RA 24..156 1..136 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:40:29 Download gff for FMO10174.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 18389982..18390040 1..60 95 -> Plus
2R 18390107..18390180 61..136 94   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:10 Download gff for FMO10174.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14277487..14277545 1..60 95 -> Plus
arm_2R 14277612..14277685 61..136 94   Plus