Clone FMO10227 Report

Search the DGRC for FMO10227

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:27
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRm62-RE
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10227.5prime Sequence

197 bp (197 high quality bases) assembled on 2010-11-11

> FMO10227.5prime
CAGTCGACATGCGAGCAAAGGCACCACACGATCGCGACTTTGGTCACAGT
GGACGTGGCGGTCGCGGAGGCGATCGAGGCGGCGATGATCGGCGAGGAGG
CGGCGGCGGAGGCAATCGCTTCGGTGGCGGCGGTGGCGGTGGCGATTACC
ACGGCATAAGGAATGGACGCGTCGAGAAGCGACGCGATGACCGCGGA

FMO10227.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:03:34
Subject Length Description Subject Range Query Range Score Percent Strand
Rm62-RI 3153 CG10279-RI 679..868 8..197 950 100 Plus
Rm62-RE 3160 CG10279-RE 691..880 8..197 950 100 Plus
Rm62-RH 2760 CG10279-RH 296..480 13..197 895 98.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:03:33
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 6004949..6005126 197..20 890 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:03:34 has no hits.

FMO10227.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:44 Download gff for FMO10227.5prime
Subject Subject Range Query Range Percent Splice Strand
Rm62-RE 418..612 1..196 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:16:03 Download gff for FMO10227.5prime
Subject Subject Range Query Range Percent Splice Strand
Rm62-RE 685..879 1..196 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:45:40 Download gff for FMO10227.5prime
Subject Subject Range Query Range Percent Splice Strand
Rm62-RE 685..879 1..196 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:45:40 Download gff for FMO10227.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 6004950..6005126 20..196 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:16:03 Download gff for FMO10227.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 1830672..1830848 20..196 100 <- Minus