Clone FMO10395 Report

Search the DGRC for FMO10395

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:103
Well:95
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34200-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10395.5prime Sequence

182 bp (182 high quality bases) assembled on 2010-11-12

> FMO10395.5prime
CAGTCGACATGGTAAAGTCTTCAAATCCCCTGAGCATCGTGCGCAGCATT
TACAACAACGAATTTCAATGGATGCTGGTCAAGAGCTACGGACTTTTCTT
CTTGGGAGTGCGTTTGGCCAAGGAGTTCGTGGGTGTCGAACTGATGCCGT
CGCTGGGGCCAGCCGCAAGCTTTCTAGACCAT

FMO10395.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:08:54
Subject Length Description Subject Range Query Range Score Percent Strand
CG34200-RA 321 CG34200-RA 103..258 9..164 765 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:08:52
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 5757910..5758004 70..164 475 100 Plus
2R 25286936 2R 5757764..5757826 9..71 300 98.4 Plus
Blast to na_te.dros performed on 2014-11-26 17:08:53 has no hits.

FMO10395.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:15:46 Download gff for FMO10395.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34200-RA 63..231 1..169 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:19:56 Download gff for FMO10395.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34200-RA 94..262 1..169 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:49:07 Download gff for FMO10395.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34200-RA 94..262 1..169 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:49:07 Download gff for FMO10395.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 5757755..5757825 1..70 92 -> Plus
2R 5757911..5758008 71..169 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:19:56 Download gff for FMO10395.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 1645260..1645330 1..70 92 -> Plus
arm_2R 1645416..1645513 71..169 97   Plus