Clone FMO10636 Report

Search the DGRC for FMO10636

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:106
Well:36
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34159-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10636.5prime Sequence

467 bp (467 high quality bases) assembled on 2011-06-24

> FMO10636.5prime
CACTCGACATGGATCGCAATAATGGACGCTATCCCTACAACATTAGGCGG
CAGAACAGCGGGCACAATGCGCCGCACAGCTACCATCACCACCATAACAA
CAATTCGGCGGCGGGGGCGTCCAATTCGCCGGGATACAATAACCACAGTG
CCGGAAACTCTCCGTCCGTCGGTGGCCATAACAACAGCAATCCGCTCTAC
GCCTCCGCCGCCGGACAGCAGCAGCAACAACAGCAACCACAGAGCCTGCC
AATCTCGCAGCACGATGAGCTCATCCGGTACATCCGGGGGGCATGGATCA
AGGTCTACGAACAGGGTCCACCTGTGCTGTACTGCAACGAATCCGACAAT
CAGCTGAAGAACTTTAAGCCATTCGATTTGGAGGAGTACTGGGGCCAGCG
CCTGGTGCAGAACATCCATGTGACCACCACGCAGGCCGGTGGACACCAGG
CAAGCTTTCTAGACCAT

FMO10636.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 23:38:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG34159-RA 936 CG34159-RA 128..570 7..449 2215 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 23:38:39
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 10203382..10203661 304..25 1400 100 Minus
2L 23513712 2L 10202886..10203034 449..301 745 100 Minus
Blast to na_te.dros performed 2014-11-26 23:38:41
Subject Length Description Subject Range Query Range Score Percent Strand
roo 9092 roo DM_ROO 9092bp 1050..1138 153..242 131 64.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2318..2537 34..251 127 57.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1557..1594 216..252 124 84.2 Plus
roo 9092 roo DM_ROO 9092bp 1053..1121 201..270 122 65.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2336..2402 175..242 120 69.6 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3257..3319 175..241 119 69.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2309..2364 215..270 118 67.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2596..2659 180..241 117 67.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2408..2444 215..251 113 78.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6796..6823 215..242 113 89.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2312..2483 71..242 112 54.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6840..6907 180..242 111 69.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2303..2348 198..242 110 73.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2803..2851 214..262 110 69.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6829..6884 215..270 109 66.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2385..2411 216..242 108 88.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2802..2876 176..248 108 64 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6391..6571 68..251 107 58 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6733..6791 215..270 107 69.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6754..6812 215..270 107 69.5 Plus
roo 9092 roo DM_ROO 9092bp 1135..1162 215..242 104 85.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1505..1541 206..242 104 75.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 5654..5690 215..251 104 75.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6775..6802 215..242 104 85.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6866..6923 179..234 104 71.2 Plus

FMO10636.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-09-21 13:42:06 Download gff for FMO10636.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34159-RA 122..580 1..455 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 15:37:42 Download gff for FMO10636.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34159-RA 119..577 1..455 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:48:24 Download gff for FMO10636.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34159-RA 119..577 1..455 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 00:48:24 Download gff for FMO10636.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 10203384..10203660 26..302 100 <- Minus
2L 10202879..10203032 303..455 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 15:37:42 Download gff for FMO10636.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 10202879..10203032 303..455 98 <- Minus
arm_2L 10203384..10203660 26..302 100 <- Minus