Clone FMO10647 Report

Search the DGRC for FMO10647

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:106
Well:47
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34386-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10647.5prime Sequence

1087 bp (962 high quality bases) assembled on 2011-06-24

> FMO10647.5prime
CAGTCGACATGTGTTCCAAAGCATTGCTGCTCCTGGCCGTCATTCTAGCT
GCTCGCTGTTTTGGTAGTGGCTCTTCCAGACGAACGCTCGCCATGGCCTG
CGAGGAGACGATGGAATCGACGCCGGGGCTCAAAAACAATAGATATGGCT
ATAGAAGCGCCACGGACAACAACTACAACGATTACAACTACAAGTGGGAG
CACGGGGATGTGGACGTTGATGGCATTGCAGATAGCAACGAGGACGACAA
CAATGACAACTATAACTACAACAAAGCACCGGCCAAATGGCAGCAGCAAC
AGCAGCAAAAACTCTACGGAAATCCCATCCACAGCATATACGACAGGCAG
CAACATCTACAACGGCAGCAGCAGCAGCAACATGAGCAGCAGCAACAACA
GCAACATCAACAGCGGCAACTCGAACAGCAGCAACAGGGATTGGGAATGG
AAATGGGACTGGGACAGTTTGATGATGATCCAGAGAATGCTCGCAACGAC
TTCCGTCTGCAATTGTCCGACTTAAATGCGGCCGTTCAAGGTATGGGCAG
GTTTGCTGTTACCCAGGACCAGAACAAAGACCAGGACAACAGCAATAGTA
ATAGCAACAGCAATGGCAACAGCAACAGCATCATCAAGGACAACAGCAAC
ATCGACTGGCTGCAGCCGATGGAGGAGCATGAGCAATTGTTGCTGGAGCG
TCGCAGCCGCAGCAGCAACATCAACCAAAGGTCAGCCATGGATGAGCAGC
GGAGCAGGGAACCAGGTCAGCCCGAGTACACCAACAATGAGTTACCATCT
GGCGGTCTAGATGATGTGGACATTGAGGGCGAGGAGGATTACGCATGTCA
AGAGGAGACGCAGACGACTGAGTTCACAGATGCCCTACGGATACAGAACG
TGCGCAAGCGCGCGTTCGCAGTGTAATGCCACCGGTACCATTCTGGGCCC
CAATCCCAGCTCAGATGGGGTAGTCACTATCAGTCGTGTGCCCCACAAAT
CGGTGACCGTGAGTGAAAGCGGCGATACGTCCCATCACTATGTGAGTATG
TGCCACAACTACTCAACGCAGCTCAGATCTTAACTTG

FMO10647.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 23:39:29
Subject Length Description Subject Range Query Range Score Percent Strand
CG34386-RD 2180 CG34386-RD 507..1594 8..1072 4835 97.5 Plus
CG34386-RC 1891 CG34386-RC 218..1305 8..1072 4835 97.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 23:39:22
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18089961..18090667 26..732 3505 99.7 Plus
2R 25286936 2R 18092550..18092801 729..972 845 96.4 Plus
3R 32079331 3R 27737534..27737576 588..630 185 95.3 Plus
Blast to na_te.dros performed 2014-11-26 23:39:26
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6716..6918 230..436 376 67.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6715..6883 270..437 365 70.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2301..2501 231..437 363 67.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6713..6901 248..434 354 68.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2308..2690 286..661 347 57 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6741..6943 234..437 325 64.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2314..2524 234..436 324 64.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2356..2550 234..434 306 65.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2294..2434 282..436 284 69.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2411 326..437 282 76.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2305..2446 289..436 275 69.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6714..6878 574..736 270 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2359..2897 234..730 269 55.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2767..2933 275..437 249 65.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6740..6902 564..728 244 65.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2318..2512 563..756 242 62.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6456..6898 286..730 233 55.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2293..2494 590..786 229 63.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6766..6952 232..416 228 61.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6761..6944 564..747 226 61.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2346..2502 564..725 223 64.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2752..2946 244..438 209 60.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2587..3032 234..686 204 56.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6715..6848 594..725 204 66.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6845..7011 564..729 203 63.8 Plus
roo 9092 roo DM_ROO 9092bp 1067..1164 564..657 199 72.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2302..2451 576..725 182 59.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6738..7037 153..438 177 56.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6809..6896 564..653 175 69.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6815..6939 564..685 169 63.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1494..1581 558..653 164 68.8 Plus
BS 5142 BS BS 5142bp 2011..2112 586..688 153 63.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1509..1589 561..637 144 66.7 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3279..3346 593..660 142 67.6 Plus
roo 9092 roo DM_ROO 9092bp 1059..1130 580..653 140 67.6 Plus
rover 7318 rover ROVER 7318bp 1224..1294 559..625 130 67.6 Plus
Doc3-element 4740 Doc3-element DOC3 4740bp 518..568 586..636 129 72.5 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3285..3351 587..653 128 65.7 Plus

FMO10647.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-09-21 13:42:12 Download gff for FMO10647.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34386-RC 212..1305 1..1072 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 15:42:11 Download gff for FMO10647.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34386-RC 212..1305 1..1072 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:48:41 Download gff for FMO10647.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34386-RC 212..1305 1..1072 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 00:48:41 Download gff for FMO10647.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 18089962..18090665 27..730 99 -> Plus
2R 18092552..18092798 731..969 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 15:42:11 Download gff for FMO10647.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 13977467..13978170 27..730 99 -> Plus
arm_2R 13980057..13980303 731..969 96 -> Plus