Clone FMO10743 Report

Search the DGRC for FMO10743

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:107
Well:43
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpS28a-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10743.5prime Sequence

218 bp (218 high quality bases) assembled on 2011-11-14

> FMO10743.5prime
CAGTCGACATGGACAAGCCTCAGTACGCTCGCGTGGTCGAGATCCTTGGA
CGCACTGGATCCCAAGGGCAGTGCACCCAGGTGCGGGTGGAGTTCCTCGG
CGACCAAAGCCGCCAGATTATTCGGAATGTCAAAGGACCTGTTCGCGTGG
GCGACATCCTGTCGCTGCTGGAAACTGAACGCGAGGCCAGGAGACTGCGC
GCAAGCTTTCTAGACCAT

FMO10743.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:26:24
Subject Length Description Subject Range Query Range Score Percent Strand
RpS28a-RA 304 CG15527-RA 50..242 8..200 965 100 Plus
RpS28b-RB 972 CG2998-RB 133..282 51..200 330 81.3 Plus
RpS28b-RA 520 CG2998-RA 133..282 51..200 330 81.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:26:22
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 30022407..30022599 200..8 965 100 Minus
X 23542271 X 9554755..9554904 51..200 330 81.3 Plus
Blast to na_te.dros performed on 2014-11-27 20:26:22 has no hits.

FMO10743.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-15 11:41:24 Download gff for FMO10743.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS28a-RA 1..195 9..203 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:51:07 Download gff for FMO10743.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS28a-RA 43..242 1..200 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:21:48 Download gff for FMO10743.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS28a-RA 43..242 1..200 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:21:48 Download gff for FMO10743.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 30022407..30022602 1..200 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:51:07 Download gff for FMO10743.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 25848129..25848324 1..200 98   Minus