FMO10785.5prime Sequence
197 bp (197 high quality bases) assembled on 2011-11-14
> FMO10785.5prime
CAGTCGACATGAAATACTTTGTGGTCCTTGTCGTCCTGGCCCTCATTTTG
GCCATCAGCGTGGGTCCTTCGGATGCAGTATTTATTGATATTCTTGACAA
AGTGGAAAACGCAATACACAATGCTGCTCAAGTGGGAATTGGCTTTGCTA
AGCCCTTTGAAAAATTGATCAATCCGAAGGCAAGCTTTCTAGACCAT
FMO10785.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:31:09
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Anp-RB | 373 | CG1361-RB | 38..208 | 9..179 | 855 | 100 | Plus |
Anp-RA | 272 | CG1361-RA | 38..208 | 9..179 | 855 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:31:06
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 30209985..30210081 | 9..105 | 485 | 100 | Plus |
3R | 32079331 | 3R | 30210142..30210217 | 104..179 | 380 | 100 | Plus |
Blast to na_te.dros performed on 2014-11-27 20:31:08 has no hits.
FMO10785.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-15 11:41:47 Download gff for
FMO10785.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Anp-RA | 38..213 | 9..187 | 97 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:53:25 Download gff for
FMO10785.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Anp-RA | 38..213 | 9..187 | 97 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:23:43 Download gff for
FMO10785.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Anp-RA | 38..213 | 9..187 | 97 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:23:43 Download gff for
FMO10785.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 30209985..30210080 | 9..104 | 100 | -> | Plus |
3R | 30210143..30210222 | 105..187 | 95 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:53:25 Download gff for
FMO10785.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 26035707..26035802 | 9..104 | 100 | -> | Plus |
arm_3R | 26035865..26035944 | 105..187 | 95 | | Plus |