Clone FMO10785 Report

Search the DGRC for FMO10785

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:107
Well:85
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAnp-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10785.5prime Sequence

197 bp (197 high quality bases) assembled on 2011-11-14

> FMO10785.5prime
CAGTCGACATGAAATACTTTGTGGTCCTTGTCGTCCTGGCCCTCATTTTG
GCCATCAGCGTGGGTCCTTCGGATGCAGTATTTATTGATATTCTTGACAA
AGTGGAAAACGCAATACACAATGCTGCTCAAGTGGGAATTGGCTTTGCTA
AGCCCTTTGAAAAATTGATCAATCCGAAGGCAAGCTTTCTAGACCAT

FMO10785.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:31:09
Subject Length Description Subject Range Query Range Score Percent Strand
Anp-RB 373 CG1361-RB 38..208 9..179 855 100 Plus
Anp-RA 272 CG1361-RA 38..208 9..179 855 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:31:06
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 30209985..30210081 9..105 485 100 Plus
3R 32079331 3R 30210142..30210217 104..179 380 100 Plus
Blast to na_te.dros performed on 2014-11-27 20:31:08 has no hits.

FMO10785.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-15 11:41:47 Download gff for FMO10785.5prime
Subject Subject Range Query Range Percent Splice Strand
Anp-RA 38..213 9..187 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:53:25 Download gff for FMO10785.5prime
Subject Subject Range Query Range Percent Splice Strand
Anp-RA 38..213 9..187 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:23:43 Download gff for FMO10785.5prime
Subject Subject Range Query Range Percent Splice Strand
Anp-RA 38..213 9..187 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:23:43 Download gff for FMO10785.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 30209985..30210080 9..104 100 -> Plus
3R 30210143..30210222 105..187 95   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:53:25 Download gff for FMO10785.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 26035707..26035802 9..104 100 -> Plus
arm_3R 26035865..26035944 105..187 95   Plus