Clone FMO10818 Report

Search the DGRC for FMO10818

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:108
Well:18
Vector:pMK33-CFH-BD
Associated Gene/TranscriptIM14-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10818.5prime Sequence

164 bp (164 high quality bases) assembled on 2011-11-17

> FMO10818.5prime
CAGTCGACATGAACTGTCTGAAGATCTGCGGCTTTTTCTTCGCTCTGATT
GCGGCTTTGGCGACGGCGGAGGCTGGCACCCAAGTCATTCATGCTGGCGG
ACACACGTTGATTCAAACTGATCGCTCGCAGTATATACGCAAAAACGCAA
GCTTTCTAGACCAT

FMO10818.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:33:33
Subject Length Description Subject Range Query Range Score Percent Strand
IM14-RA 223 CG33990-RA 32..171 7..146 700 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:33:31
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 20870555..20870626 75..146 360 100 Plus
2R 25286936 2R 20870423..20870492 7..76 350 100 Plus
Blast to na_te.dros performed 2014-11-27 20:33:32
Subject Length Description Subject Range Query Range Score Percent Strand
I-element 5371 I-element DMIFACA 5371bp Derived from M14954 (g157749) (Rel. 44, Last updated, Version 2). 2485..2518 130..163 98 76.5 Plus

FMO10818.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-23 09:58:22 Download gff for FMO10818.5prime
Subject Subject Range Query Range Percent Splice Strand
IM14-RA 1..141 9..150 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:54:44 Download gff for FMO10818.5prime
Subject Subject Range Query Range Percent Splice Strand
IM14-RA 26..174 1..150 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:24:49 Download gff for FMO10818.5prime
Subject Subject Range Query Range Percent Splice Strand
IM14-RA 26..174 1..150 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:24:49 Download gff for FMO10818.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 20870417..20870491 1..75 96 -> Plus
2R 20870556..20870629 76..150 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:54:44 Download gff for FMO10818.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16757922..16757996 1..75 96 -> Plus
arm_2R 16758061..16758134 76..150 97   Plus