Clone FMO10819 Report

Search the DGRC for FMO10819

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:108
Well:19
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42872-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10819.5prime Sequence

149 bp (149 high quality bases) assembled on 2011-11-17

> FMO10819.5prime
CAGTCGACATGCCTTGCAAGGGATGTGGAAACAACTGCCAGTGCTCAGCC
GGAAAGTGCGGAGGTAACTGCGCCGGAAACAGCCAATGCCAATGCGCCGC
CAAGACGGGAGCCAAGTGCTGCCAGGCCAAGGCAAGCTTTCTAGACCAT

FMO10819.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:33:43
Subject Length Description Subject Range Query Range Score Percent Strand
MtnE-RA 344 CG42872-RA 71..193 9..131 615 100 Plus
MtnE-RB 604 CG42872-RB 71..193 9..131 615 100 Plus
MtnB-RC 456 CG4312-RC 94..161 14..81 175 83.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:33:40
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20534432..20534529 131..34 490 100 Minus
Blast to na_te.dros performed on 2014-11-27 20:33:41 has no hits.

FMO10819.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-23 09:58:22 Download gff for FMO10819.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42872-RA 64..193 1..131 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:54:47 Download gff for FMO10819.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnE-RA 64..193 1..131 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:24:53 Download gff for FMO10819.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnE-RB 64..193 1..131 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:24:53 Download gff for FMO10819.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 20534432..20534529 34..131 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:54:47 Download gff for FMO10819.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 16360154..16360251 34..131 100 <- Minus