Clone FMO10820 Report

Search the DGRC for FMO10820

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:108
Well:20
Vector:pMK33-CFH-BD
Associated Gene/TranscriptDup99B-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10820.5prime Sequence

188 bp (188 high quality bases) assembled on 2011-11-17

> FMO10820.5prime
CAGTCGACATGAAGACTCCGCTATTTCTCCTCTTGGTCGTATTGGCTTCC
CTCCTGGGATTGGCCTTATCCCAGGATCGAAATGATACGGAGTGGATCCA
AAGTCAGAAGGATCGTGAGAAGTGGTGCCGGCTAAACTTAGGACCCTACC
TCGGTGGCAGATGCCGAAAAGCAAGCTTTCTAGACCAT

FMO10820.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:33:51
Subject Length Description Subject Range Query Range Score Percent Strand
Dup99B-RA 257 CG33495-RA 28..190 8..170 815 100 Plus
Dup99B-RB 310 CG33495-RB 28..143 8..123 565 99.1 Plus
Dup99B-RB 310 CG33495-RB 188..243 115..170 280 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:33:48
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 29715235..29715350 123..8 565 99.1 Minus
3R 32079331 3R 29715135..29715190 170..115 280 100 Minus
Blast to na_te.dros performed on 2014-11-27 20:33:50 has no hits.

FMO10820.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-23 09:58:23 Download gff for FMO10820.5prime
Subject Subject Range Query Range Percent Splice Strand
Dup99B-RA 20..195 1..176 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:54:52 Download gff for FMO10820.5prime
Subject Subject Range Query Range Percent Splice Strand
Dup99B-RA 20..195 1..176 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:24:58 Download gff for FMO10820.5prime
Subject Subject Range Query Range Percent Splice Strand
Dup99B-RA 20..195 1..176 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:24:58 Download gff for FMO10820.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 29715130..29715190 115..176 96 <- Minus
3R 29715244..29715358 1..114 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:54:52 Download gff for FMO10820.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 25540852..25540912 115..176 96 <- Minus
arm_3R 25540966..25541080 1..114 97   Minus