FMO10873.5prime Sequence
281 bp (281 high quality bases) assembled on 2011-11-17
> FMO10873.5prime
CAGTCGACATGGACGGCTTCTACAGCAACAGCAACAGTTGCAGCAACAAC
GGCGGCTACTGCTCGCAGGGTTCGCGAAGTGGCAACTGCGGATCGTGTGG
CAACTGCCCCGGTGGCCACTGCCCCCGAATGGAGGCGGGTGGTAGTAGCT
ACGGCGCTCGAGGAATGAGCCAGCCGGGTTGTCCTGGCGGCAACTGTTGT
CCCGGCGGAAGGTGTTCGGCCGGAAAGTCGCGCTTCAATCCAGACTGGCA
GTATGGTGGACGCGCACGCTTTCTAGACCAT
FMO10873.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:39:59
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG9016-RB | 719 | CG9016-RB | 123..378 | 8..263 | 1280 | 100 | Plus |
| CG9016-RA | 724 | CG9016-RA | 128..383 | 8..263 | 1280 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:39:55
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2L | 23513712 | 2L | 5923217..5923472 | 263..8 | 1280 | 100 | Minus |
Blast to na_te.dros performed 2014-11-27 20:39:56
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| roo | 9092 | roo DM_ROO 9092bp | 1114..1164 | 13..63 | 129 | 72.5 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2436..2485 | 14..63 | 124 | 72 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2379..2415 | 20..56 | 122 | 81.1 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6761..6824 | 23..89 | 120 | 68.7 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6740..6779 | 23..62 | 119 | 77.5 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6782..6815 | 23..56 | 116 | 82.4 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2578..2628 | 2..50 | 115 | 72.5 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2613..2658 | 17..59 | 115 | 76.1 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2379..2424 | 5..50 | 113 | 71.7 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6815..6854 | 23..62 | 110 | 75 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6803..6836 | 23..56 | 107 | 79.4 | Plus |
| roo | 9092 | roo DM_ROO 9092bp | 1059..1120 | 27..91 | 101 | 66.2 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 1545..1575 | 23..53 | 101 | 80.6 | Plus |
| roo | 9092 | roo DM_ROO 9092bp | 1097..1139 | 23..62 | 100 | 74.4 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6871..6917 | 13..59 | 100 | 68.1 | Plus |
FMO10873.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-23 09:58:53 Download gff for
FMO10873.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG9016-RA | 111..382 | 1..267 | 97 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 17:57:47 Download gff for
FMO10873.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG9016-RA | 118..389 | 1..267 | 97 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:27:24 Download gff for
FMO10873.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG9016-RA | 118..389 | 1..267 | 97 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:27:24 Download gff for
FMO10873.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2L | 5923211..5923475 | 1..267 | 97 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 17:57:47 Download gff for
FMO10873.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2L | 5923211..5923475 | 1..267 | 97 | | Minus |
