Clone FMO11027 Report

Search the DGRC for FMO11027

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:110
Well:27
Vector:pMK33-CFH-BD
Associated Gene/TranscriptUcrh-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11027.5prime Sequence

281 bp (281 high quality bases) assembled on 2011-11-18

> FMO11027.5prime
CAGTCGACATGGCTTTTAGGAACTGGTTTTCGCTTCCCGCCGTCAGAGCT
GATGACGAAGAGGACTTAGTTGACCCTCAAGCAGTTTTAAGGGAAAAATG
TCAAGCTAAAGGTCACATAGAATCCTTGTACAATAAGTACCAAGAGTGCA
ATGATCGTGTTAATGGGCGATCCAAAACAACTGAGACTTGCATCGAAGAA
TTATTTGACTATGTTGCTGAGTTAGATCATTGCGTTTCGCACAGTCTTTT
TACAAAGCTTAAGGCAAGCTTTCTAGACCAT

FMO11027.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:56:52
Subject Length Description Subject Range Query Range Score Percent Strand
Ucrh-RD 506 CG41623-RD 95..349 9..263 1275 100 Plus
Ucrh-RC 434 CG41623-RC 97..351 9..263 1275 100 Plus
Ucrh-RB 416 CG41623-RB 79..333 9..263 1275 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:56:50
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 25121043..25121214 92..263 860 100 Plus
3L 28110227 3L 25120902..25120991 9..98 435 98.9 Plus
2R 25286936 2R 8677379..8677576 50..247 435 81.3 Plus
Blast to na_te.dros performed on 2014-11-27 20:56:51 has no hits.

FMO11027.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-11-23 10:00:16 Download gff for FMO11027.5prime
Subject Subject Range Query Range Percent Splice Strand
Ucrh-RD 102..359 9..267 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 18:06:38 Download gff for FMO11027.5prime
Subject Subject Range Query Range Percent Splice Strand
Ucrh-RB 79..336 9..267 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:34:24 Download gff for FMO11027.5prime
Subject Subject Range Query Range Percent Splice Strand
Ucrh-RB 79..336 9..267 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:34:24 Download gff for FMO11027.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 25120902..25120985 9..92 100 -> Plus
3L 25121044..25121217 93..267 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 18:06:38 Download gff for FMO11027.5prime
Subject Subject Range Query Range Percent Splice Strand
3LHet 606358..606441 9..92 100 -> Plus
3LHet 606500..606673 93..267 98   Plus