Clone FMO11104 Report

Search the DGRC for FMO11104

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:111
Well:4
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42866-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11104.5prime Sequence

188 bp (188 high quality bases) assembled on 2011-12-01

> FMO11104.5prime
CAGTCGACATGCGGTTGATTTTTTTCTGCTTGTGCCTCTTTTTGTCCCTG
GAGCTAGTAGTGCCCAGACATGTCGTGGGCCACGATGGATACCACAACAT
CGAGAAGGAAAAGCGCTGGAAAAACTGGCCAGCACGTGTGAGGCACCACC
ATAAACAACGTAACTCCATCGCAAGCTTTCTAGACCAT

FMO11104.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:03:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG42866-RA 403 CG42866-RA 24..185 9..170 810 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 00:03:06
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 19961442..19961580 170..32 695 100 Minus
Blast to na_te.dros performed 2014-11-27 00:03:07
Subject Length Description Subject Range Query Range Score Percent Strand
Dbuz\Osvaldo 9045 Dbuz\Osvaldo DBU133521 9045bp Derived from AJ133521 (Rel. 60, Last updated, Version 2). 3002..3041 116..157 115 78.6 Plus

FMO11104.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-12-01 08:56:49 Download gff for FMO11104.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42866-RA 1..162 9..170 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 16:10:06 Download gff for FMO11104.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42866-RA 24..185 9..170 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:57:43 Download gff for FMO11104.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42866-RA 24..185 9..170 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 00:57:43 Download gff for FMO11104.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 19961442..19961579 33..170 100 <- Minus
2L 19961639..19961662 9..32 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 16:10:06 Download gff for FMO11104.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 19961442..19961579 33..170 100 <- Minus
arm_2L 19961639..19961662 9..32 100   Minus