Clone FMO11187 Report

Search the DGRC for FMO11187

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:111
Well:87
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcib-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11187.5prime Sequence

317 bp (317 high quality bases) assembled on 2011-12-01

> FMO11187.5prime
CAGTCGACATGGCCGCCCCAGCACCAGCACTCAAGGATCTGCCCAAGGTG
GCCGAGAACCTGAAAAGCCAGTTGGAGGGATTCAACCAGGACAAACTGAA
GAACGCTAGCACCCAGGAGAAGATCATTCTTCCCACCGCCGAAGATGTGG
CTGCCGAGAAGACCCAACAGTCGATCTTCGAGGGCATCACCGCTTTCAAT
CAGAACAACTTGAAGCACACGGAGACCAACGAGAAGAACCCGTTGCCCGA
TAAGGAAGGAGAAGGAGAAGAATCAGTTCATCGCCGGCATCGAGAACTTG
CAAGCTTTCTAGACCAT

FMO11187.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 00:15:14
Subject Length Description Subject Range Query Range Score Percent Strand
cib-RC 885 CG4944-RC 162..452 9..299 1455 100 Plus
cib-RE 911 CG4944-RE 177..478 9..299 1335 96.4 Plus
cib-RD 1502 CG4944-RD 423..724 9..299 1335 96.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 00:15:11
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 4109689..4109824 9..144 680 100 Plus
X 23542271 X 4109895..4110011 143..259 585 100 Plus
X 23542271 X 4110161..4110203 257..299 215 100 Plus
Blast to na_te.dros performed on 2014-11-27 00:15:13 has no hits.

FMO11187.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-12-01 08:57:44 Download gff for FMO11187.5prime
Subject Subject Range Query Range Percent Splice Strand
cib-RC 152..456 1..305 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 16:15:50 Download gff for FMO11187.5prime
Subject Subject Range Query Range Percent Splice Strand
cib-RC 154..458 1..305 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 01:02:30 Download gff for FMO11187.5prime
Subject Subject Range Query Range Percent Splice Strand
cib-RC 154..458 1..305 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 01:02:30 Download gff for FMO11187.5prime
Subject Subject Range Query Range Percent Splice Strand
X 4109685..4109824 4..144 98 -> Plus
X 4109897..4110010 145..258 100 -> Plus
X 4110163..4110205 259..300 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 16:15:50 Download gff for FMO11187.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 4003718..4003857 4..144 98 -> Plus
arm_X 4003930..4004043 145..258 100 -> Plus
arm_X 4004196..4004238 259..300 97 -> Plus