Clone FMO11514 Report

Search the DGRC for FMO11514

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:115
Well:14
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42848-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11514.5prime Sequence

314 bp (314 high quality bases) assembled on 2012-05-14

> FMO11514.5prime
CAGTCGACATGGAATGCGAAGCTGCGGAGGGACGCGATTCGAGCGAGGCA
GATGAAGAAGATGTTAGCCCAAGCGGATGCAGAAGTAAAGTACGAAGAGG
ACAAGGGTCCATGACCAGGACCAGTCTGGACTGGAGGCGCTGCCATGGAT
CGGGAGGAGGTCGAGGAGCAGCAGGGCGATGGGAATTCGAGAAGGGGCAG
CATCATCAGCAACAGCAGCATAAACAAAACGACCATCAAAGCCGCAGGAA
CGGAAGAACCATACACTGGACGAAATCAAACCAAAGTAAGGAAGGAGCAA
GCTTTCTAGACCAT

FMO11514.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 02:41:16 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 02:41:13
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 18946718..18947005 9..296 1425 99.7 Plus
Blast to na_te.dros performed 2014-11-28 02:41:14
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2290..2416 137..261 170 61.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2359..2468 190..300 165 65.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2256..2416 145..299 158 61.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6777..6870 167..261 148 64.6 Plus
roo 9092 roo DM_ROO 9092bp 1086..1161 164..238 142 70.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2779..2858 184..262 136 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6756..6859 193..300 134 61.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6735..6841 193..300 132 60.6 Plus
roo 9092 roo DM_ROO 9092bp 1083..1176 193..284 131 62.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2490..2539 198..246 130 76 Plus
roo 9092 roo DM_ROO 9092bp 1092..1155 190..252 128 68.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2390..2445 197..251 124 71.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6777..6843 193..261 124 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2808..2888 198..279 119 63.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6831..6894 199..261 119 67.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6797 185..259 118 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6794..6855 198..261 117 67.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6837..6912 164..238 116 63.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6752..6819 198..261 115 66.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1558..1609 193..243 113 71.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6849..6897 190..238 110 69.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2326..2392 193..261 106 63.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2633..2665 197..229 102 78.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2785..2832 205..251 102 70.8 Plus

FMO11514.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-05-14 09:59:01 Download gff for FMO11514.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42848-RA 408..709 1..304 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:36:12 Download gff for FMO11514.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 18946712..18947013 1..304 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:36:12 Download gff for FMO11514.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 18946712..18947013 1..304 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:24:20 Download gff for FMO11514.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 18946712..18947013 1..304 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:24:20 Download gff for FMO11514.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 18946712..18947013 1..304 97   Plus