Clone FMO11546 Report

Search the DGRC for FMO11546

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:115
Well:46
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG30154-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11546.5prime Sequence

218 bp (218 high quality bases) assembled on 2012-05-14

> FMO11546.5prime
CAGTCGACATGTACCTACGTCAACAACTCTGGGTTCTCTTGCTCTGGCTC
TGCTTCGTCGTTCTCAGCGTGCATGGCATGCCGTGGAAATGGGGACCTGC
CTCCAATTCTGGACCCCATGGCGGACCCGCCTGGAATGGCGGAGAAGAGT
CCACCGACAATATAGTCATCCATTCGAAAAACAGCGGCAAGTGGCGTTAC
GCAAGCTTTCTAGACCAT

FMO11546.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 02:42:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG30154-RA 507 CG30154-RA 33..225 8..200 965 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 02:42:30
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 20533521..20533652 69..200 660 100 Plus
2R 25286936 2R 20533391..20533452 8..69 310 100 Plus
Blast to na_te.dros performed on 2014-11-28 02:42:31 has no hits.

FMO11546.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-05-14 09:59:15 Download gff for FMO11546.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30154-RA 9..217 1..209 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:24:58 Download gff for FMO11546.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30154-RA 25..233 1..209 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:36:43 Download gff for FMO11546.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30154-RA 24..232 1..209 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:36:43 Download gff for FMO11546.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 20533382..20533452 1..69 94 -> Plus
2R 20533522..20533659 70..209 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:24:58 Download gff for FMO11546.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16420887..16420957 1..69 94 -> Plus
arm_2R 16421027..16421164 70..209 97   Plus