Clone FMO11760 Report

Search the DGRC for FMO11760

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:117
Well:60
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15126-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11760.5prime Sequence

185 bp (185 high quality bases) assembled on 2012-05-29

> FMO11760.5prime
CAGTCGACATGCCACCACCACACGGAGGACCCGGAGGCCATGGACATGGA
GGACCGCATCATGGCGGACCCCCGCATCATGGAGGCCACCATGGACCGCC
ACATCACCATGGACCGCCCCATCATCACCACGGACCTCGTCCCTGCTGCC
TTTGCTGCACAATTTCAGCAAGCTTTCTAGACCAT

FMO11760.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 02:53:54
Subject Length Description Subject Range Query Range Score Percent Strand
CG15126-RA 281 CG15126-RA 48..206 9..167 795 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 02:53:52
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 19690845..19691003 9..167 795 100 Plus
Blast to na_te.dros performed on 2014-11-28 02:53:53 has no hits.

FMO11760.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-05-29 09:36:10 Download gff for FMO11760.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 1..162 9..171 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:31:23 Download gff for FMO11760.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 48..214 9..176 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:41:56 Download gff for FMO11760.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 48..214 9..176 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:41:56 Download gff for FMO11760.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 19690845..19691011 9..176 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:31:23 Download gff for FMO11760.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 15578350..15578516 9..176 97   Plus