Clone FMO11779 Report

Search the DGRC for FMO11779

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:117
Well:79
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8446-RE
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11779.5prime Sequence

266 bp (266 high quality bases) assembled on 2012-05-29

> FMO11779.5prime
CAGTCGACATGGTTCGACCAACACTAGTTGCGCTGGCTAAGCGCGTACCG
CTCATACACTTCCGCAAGGGTGGTGCAGGAGTGCCGGGCGCCCAGACAGC
AAACCAGAAGGCAAGTTCCCAGGCCGCAGGAGGCAAAAAGTTGGCCGGTG
GACCAGCAATTGAGGACTACGAGCTGCCGGCACGATTTGCCCGCAAGCCA
ATTGATCCCGAAGAGGCGGCTTACATTAATAATGGGGGTATTCCAAACGC
AAGCTTTCTAGACCAT

FMO11779.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 02:54:59
Subject Length Description Subject Range Query Range Score Percent Strand
CG44242-RB 456 CG44242-RB 88..327 9..248 1200 100 Plus
CG44242-RA 426 CG44242-RA 187..297 138..248 555 100 Plus
CG44242-RA 426 CG44242-RA 88..189 9..110 510 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 02:54:57
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16196471..16196602 9..140 660 100 Plus
2R 25286936 2R 16196690..16196799 139..248 550 100 Plus
Blast to na_te.dros performed on 2014-11-28 02:54:58 has no hits.

FMO11779.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-05-29 09:36:23 Download gff for FMO11779.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8446-RE 78..330 1..253 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:32:07 Download gff for FMO11779.5prime
Subject Subject Range Query Range Percent Splice Strand
CG44242-RB 80..332 1..253 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:42:28 Download gff for FMO11779.5prime
Subject Subject Range Query Range Percent Splice Strand
CG44242-RB 80..332 1..253 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:42:28 Download gff for FMO11779.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 16196463..16196602 1..140 97 -> Plus
2R 16196692..16196804 141..253 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:32:07 Download gff for FMO11779.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12083968..12084107 1..140 97 -> Plus
arm_2R 12084197..12084309 141..253 98   Plus