Clone FMO11870 Report

Search the DGRC for FMO11870

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:118
Well:70
Vector:pMK33-CFH-BD
Associated Gene/TranscriptGstD2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO11870.5prime Sequence

241 bp (-60 high quality bases) assembled on 2012-06-25

> FMO11870.5prime
CCCAAGAAGCTGCCGTGATCAACCAGCGTCTGTACTTCGACATTGGGAAC
TCTGTACGAAAGCTTTGCCAAATACTACTATCCCCTTTTCCGCACTGGAA
AGCCCGGATCGGATGAGGACTTGAAGAGAATCGAAACCGCGTTTGGATTT
CTCGACACCTTCCTGGAGGGCCAGGATTATGTGGCTGGCGACCAGCTCAC
CGTGGCGGACATTGCCATCCTGTCCACTGTCTCCACGTTCG

FMO11870.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:18:26
Subject Length Description Subject Range Query Range Score Percent Strand
GstD2-RA 734 CG4181-RA 286..526 1..241 1145 98.8 Plus
GstD5-RA 840 CG12242-RA 290..530 1..241 575 83.1 Plus
GstD1-RB 843 CG10045-RB 350..429 1..80 235 87.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 03:18:24
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 12372256..12372496 1..241 1095 98.8 Plus
3R 32079331 3R 12376041..12376262 19..241 540 83.9 Plus
3R 32079331 3R 12374541..12374651 131..241 210 79.3 Plus
3R 32079331 3R 12378952..12379051 137..236 200 80 Plus
3R 32079331 3R 12373494..12373574 155..235 195 82.7 Plus
3R 32079331 3R 12380447..12380509 154..216 195 87.3 Plus
3R 32079331 3R 12368231..12368298 80..12 190 88.4 Minus
Blast to na_te.dros performed on 2014-11-28 03:18:26 has no hits.

FMO11870.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-06-25 14:50:31 Download gff for FMO11870.5prime
Subject Subject Range Query Range Percent Splice Strand
GstD2-RA 286..526 1..241 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:46:49 Download gff for FMO11870.5prime
Subject Subject Range Query Range Percent Splice Strand
GstD2-RA 286..526 1..241 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:54:06 Download gff for FMO11870.5prime
Subject Subject Range Query Range Percent Splice Strand
GstD2-RA 286..526 1..241 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:54:06 Download gff for FMO11870.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 12372256..12372496 1..241 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:46:49 Download gff for FMO11870.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 8197978..8198218 1..241 98   Plus