Clone FMO12067 Report

Search the DGRC for FMO12067

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:120
Well:67
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34423-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12067.5prime Sequence

221 bp (221 high quality bases) assembled on 2012-06-25

> FMO12067.5prime
CAGTCGACATGTCGCAGATCGGAGAACTGGGCAGTGGAGCCGGCAACGGC
GGCGGCGGCGGCGGATCCATCCGGGAGGCGGGCGGTTCATTTGGCAAAAT
GGAGGCTGCTCGCGAGGAGGAGTTCTTCTACAAGCAGCAAAAGGAGCAAC
TGAAGAACCTGAAGACCAAGACGGAGCCTAAGGCACCAGAGGCTCCCAAG
AAGGCAAGCTTTCTAGACCAT

FMO12067.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:15:00
Subject Length Description Subject Range Query Range Score Percent Strand
CG34423-RB 468 CG34423-RB 167..361 9..203 975 100 Plus
CG34423-RA 406 CG34423-RA 105..299 9..203 975 100 Plus
CG13551-RB 637 CG13551-RB 218..340 30..152 315 83.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 03:14:58
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 23358843..23358971 9..137 645 100 Plus
2R 25286936 2R 23359028..23359097 134..203 350 100 Plus
2R 25286936 2R 23382618..23382722 134..30 270 83.8 Minus
Blast to na_te.dros performed on 2014-11-28 03:14:59 has no hits.

FMO12067.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-06-25 11:41:53 Download gff for FMO12067.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34423-RB 52..260 1..209 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:44:43 Download gff for FMO12067.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34423-RA 96..304 1..209 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:52:20 Download gff for FMO12067.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34423-RA 96..304 1..209 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:52:20 Download gff for FMO12067.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 23358834..23358971 1..137 97 -> Plus
2R 23359032..23359102 138..209 95   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:44:43 Download gff for FMO12067.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 19246357..19246494 1..137 97 -> Plus
arm_2R 19246555..19246625 138..209 95   Plus