Clone FMO12091 Report

Search the DGRC for FMO12091

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:120
Well:91
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG17931-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12091.5prime Sequence

206 bp (206 high quality bases) assembled on 2012-06-25

> FMO12091.5prime
CAGTCGACATGACACGCGGCAACCAACGAGACCTGGCCCGCCAGAAGAAC
CAGAAGAAGCAGGCGGATTTGACCAAGGGAAAGCGAACCGATAACCTCAC
CGTGGAGCAAAGGAAGGCCAGGGACGCTGAGTTAATGCGGGAGAAGCAGA
AAAAAAAGGAAGAGGCCGCTGCGGCGGGCACAAGCAAAGCAAGCTTTCTA
GACCAT

FMO12091.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:15:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-RD 1367 CG17931-RD 178..357 9..188 900 100 Plus
CG17931-RC 1081 CG17931-RC 178..357 9..188 900 100 Plus
CG17931-RA 762 CG17931-RA 178..357 9..188 900 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 03:15:31
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 16358682..16358788 122..16 535 100 Minus
3R 32079331 3R 16358545..16358614 188..119 350 100 Minus
Blast to na_te.dros performed on 2014-11-28 03:15:32 has no hits.

FMO12091.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-06-25 11:42:08 Download gff for FMO12091.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 176..355 9..188 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:45:06 Download gff for FMO12091.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 178..357 9..188 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:52:36 Download gff for FMO12091.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 178..357 9..188 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:52:36 Download gff for FMO12091.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 16358683..16358788 16..121 100   Minus
3R 16358545..16358611 122..188 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:45:06 Download gff for FMO12091.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 12184267..12184333 122..188 100 <- Minus
arm_3R 12184405..12184510 16..121 100   Minus