Clone FMO12143 Report

Search the DGRC for FMO12143

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:121
Well:43
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAcp70A-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12143.5prime Sequence

191 bp (191 high quality bases) assembled on 2012-07-23

> FMO12143.5prime
CAGTCGACATGAAAACTCTAGCTCTATTCTTGGTTCTCGTTTGCGTACTC
GGCTTGGTCCAGGCCTGGGAATGGCCGTGGAATAGGAAGCCTACAAAGTT
TCCAATTCCAAGCCCCAATCCTCGTGATAAGTGGTGCCGTCTTAATTTGG
GGCCCGCCTGGGGTGGAAGATGTGCAAGCTTTCTAGACCAT

FMO12143.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 17:57:16
Subject Length Description Subject Range Query Range Score Percent Strand
SP-RA 223 CG17673-RA 4..168 9..173 825 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 17:57:14
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 13301638..13301754 9..125 585 100 Plus
3L 28110227 3L 13301818..13301867 124..173 250 100 Plus
Blast to na_te.dros performed on 2014-11-28 17:57:16 has no hits.

FMO12143.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-07-23 10:32:06 Download gff for FMO12143.5prime
Subject Subject Range Query Range Percent Splice Strand
Acp70A-RA 1..172 7..178 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:38:02 Download gff for FMO12143.5prime
Subject Subject Range Query Range Percent Splice Strand
Acp70A-RA 1..172 7..178 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:44:49 Download gff for FMO12143.5prime
Subject Subject Range Query Range Percent Splice Strand
SP-RA 1..172 7..178 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 18:44:49 Download gff for FMO12143.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 13301632..13301752 3..123 97 -> Plus
3L 13301818..13301871 124..178 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:38:02 Download gff for FMO12143.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 13294732..13294852 3..123 97 -> Plus
arm_3L 13294918..13294971 124..178 96   Plus