Clone FMO12338 Report

Search the DGRC for FMO12338

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:123
Well:38
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPsc-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12338.5prime Sequence

949 bp (785 high quality bases) assembled on 2012-10-09

> FMO12338.5prime
AGTCGACATGATGACGCCAGAATCGAAAGCAATACAGCCGGCAGCAGCAA
CAACAAAGCAAACAGCAGAAGCAACAGCAACAACAACAATGGCTCACACA
CAACAAAAGTCGCAGTTGTCAACGTTGGCGAAAACAACAACGACAACGGC
AACGAATAAGGCGGCCAAAAGCGTTGTCAGCAATGCAAATAGCAGTGGCA
ACAATTCGAGCAAAAAGCTGGCTTTGTCTCAGTCTCAGAAAACAACAACA
ACAACAACACCACCAACGACGACGACAACAACAACAGCAGCAGCAGCAGC
AGAGGCAACAACTAATGCTGATAAAATGCAAAAGCAACAGCAACTGAAGC
AGCAACTTTTCGCTGCCTGCAGCATTAAAAGTAAAAAGTGAAAACACATT
AGCAACTACTGCGAATGCAGCATTAGCAGCAGCAACAACCACAACAACAA
CAGCAACACCAGCTCTTTGTTCACCGGCAAAGCAGCAAAAACAATATTAG
AAAAACGGCATAAAGAAAGGAATCCACGCCTCCGGCTGTCGAATCCGTTG
AGGCCTCCTCCTCATCGTCATCCTCCTCCTCGTCCTCCCTCATCATCATC
GTCCTCGTGGCCGACGACAAGGAGAGCCACTTCAGAGGACGCCAGCAGCA
ATGGTGGCGCCTCCGCCGACGAGGAGAAGTCGGAGGAGGACCCACCGGCA
GCTGTGGCTGCGTCTTCAACGGCGACCACGACTTCCGATTTGGCCACAAC
TTCAAGGCCACGCCTCGTCCTTCTAACGGCCTTAATTCGCAACATCATTC
TGTCACCTGTGCCAGGGATATCTGATCATTGCAACCCCATCGTCGAGTGT
CTTGCACTCTTCTGCCACAGTTGCCTCTTTAATCACTGCGAAGGAGCGAT
TCTTGCCGCGCTGCAGATTGTCATCACAACGCCAGTCCGAACATCAAAT

FMO12338.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:09:52
Subject Length Description Subject Range Query Range Score Percent Strand
Psc-RC 6332 CG3886-RC 1006..1945 8..949 4120 96.7 Plus
Psc-RB 5671 CG3886-RB 670..1609 8..949 4120 96.7 Plus
Psc-RA 6007 CG3886-RA 1006..1945 8..949 4120 96.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:09:46
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12977325..12978163 852..8 3655 97.4 Minus
Blast to na_te.dros performed 2014-11-28 18:09:49
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2586..2985 60..463 393 60.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2388..2855 18..488 389 57.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2204..2542 138..493 362 60.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2302..2665 67..458 356 59 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2303..2678 125..506 310 56.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2673 47..421 305 58.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6725..6953 276..495 304 64.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6527..6944 53..460 303 58.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6732..6923 324..509 241 62.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6707..6909 317..510 238 61.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6659..6852 303..502 211 59.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2325..2477 329..497 205 63.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6659..6846 332..516 193 60.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2313..2412 367..463 187 67 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1194..1589 45..456 185 55.3 Plus
roo 9092 roo DM_ROO 9092bp 946..1185 231..470 185 58 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6734..6896 367..527 182 59.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2421 411..527 177 63.6 Plus
BS 5142 BS BS 5142bp 1937..2142 329..523 175 57.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6704..6821 409..527 169 62.5 Plus
roo 9092 roo DM_ROO 9092bp 980..1149 335..505 167 58.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6727..6822 417..516 166 67.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6413..6578 279..464 165 59.7 Plus
roo 9092 roo DM_ROO 9092bp 1053..1151 365..463 161 65 Plus
roo 9092 roo DM_ROO 9092bp 1073..1179 397..502 154 61.7 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3279..3396 406..520 151 63.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1512..1584 391..463 149 67.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1530..1575 418..463 149 80.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 5626..5680 394..449 142 75 Plus
Doc3-element 4740 Doc3-element DOC3 4740bp 529..632 46..152 140 63 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 983..1051 417..484 135 68.1 Plus
roo 9092 roo DM_ROO 9092bp 982..1179 239..438 129 57.8 Plus
ZAM 8435 ZAM DMZAM 8435bp Derived from AJ000387 (e1237231) ((Rel. 54, Last updated, Version 1). 2629..2728 404..502 128 61.4 Plus
Dyak\TART 8444 Dyak\TART TARTYAK 8444bp 6034..6094 401..461 124 71 Plus
TART-C 11124 TART-C TARTC 11124bp 7489..7546 401..458 118 71.2 Plus
Doc2-element 4789 Doc2-element DOC2 4789bp 538..592 403..457 113 67.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6399..6486 377..466 112 60 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 972..1011 418..457 110 75 Plus

FMO12338.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-10-09 09:33:40 Download gff for FMO12338.5prime
Subject Subject Range Query Range Percent Splice Strand
Psc-RA 995..1940 1..949 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:46:15 Download gff for FMO12338.5prime
Subject Subject Range Query Range Percent Splice Strand
Psc-RA 1000..1945 1..949 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:52:01 Download gff for FMO12338.5prime
Subject Subject Range Query Range Percent Splice Strand
Psc-RA 1000..1945 1..949 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 18:52:01 Download gff for FMO12338.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12977317..12978169 1..860 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:46:15 Download gff for FMO12338.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8864822..8865674 1..860 97   Minus