Clone FMO12367 Report

Search the DGRC for FMO12367

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:123
Well:67
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5484-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12367.5prime Sequence

271 bp (270 high quality bases) assembled on 2012-10-09

> FMO12367.5prime
GTCGACATGAACTACAATCCAAATCCGGGTATGCGGAACCGTAAGTGGGA
GAACTCCTCAGCTGCCGGTCGCCCAAGGCCGCCGAAGCGTGTGAGTGATG
TTAACGCCATGTCTACCCTCGGCTCCGATGATGGGCGGTGGCGCCACCTT
CATGGCCCCGCCCACCGGCCCCGGAATACTAGATCCCAATATGTACGGAG
CACCTGCTCCGGCCCCGGTCAACAGCTATGGCTTCGACCCCAATCTCGGC
CAGCCCTCGCAGCACATTCAT

FMO12367.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:10:45
Subject Length Description Subject Range Query Range Score Percent Strand
CG5484-RC 1522 CG5484-RC 108..370 7..270 1265 98.9 Plus
CG5484-RA 1507 CG5484-RA 137..355 51..270 1030 98.2 Plus
CG5484-RB 1495 CG5484-RB 130..343 56..270 1020 98.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:10:43
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 26718328..26718541 56..270 995 98.6 Plus
3R 32079331 3R 26717978..26718026 7..55 245 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:10:44 has no hits.

FMO12367.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-10-09 09:33:56 Download gff for FMO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5484-RC 126..393 1..271 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:46:51 Download gff for FMO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5484-RC 103..370 1..271 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:52:32 Download gff for FMO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5484-RC 103..370 1..271 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 18:52:32 Download gff for FMO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 26717973..26718026 1..55 92 -> Plus
3R 26718328..26718541 56..271 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:46:51 Download gff for FMO12367.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 22543695..22543748 1..55 92 -> Plus
arm_3R 22544050..22544263 56..271 98   Plus