Clone FMO12426 Report

Search the DGRC for FMO12426

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:124
Well:26
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG12853-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12426.5prime Sequence

187 bp (187 high quality bases) assembled on 2012-11-28

> FMO12426.5prime
GTCGACATGCCGGCAAAAAAGGAATCAAACAAGGGTGCTAAGAAAGGAGC
TGCCGCTCCAGCTGGTGCCAAGCCGACCGCCGATCCTGTGACTTCCGAAT
CGAACAACGCAGCGGAACCAGCCGCCAAGGAAGCCAAGGGTTCCAAGAAG
GGCAAAGGCAAAAAGAAGGCAAGCTTTCTAGACCATT

FMO12426.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:38:04
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-RA 329 CG12853-RA 84..245 7..168 810 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:38:02
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14933668..14933829 7..168 810 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:38:03 has no hits.

FMO12426.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-11-28 09:33:41 Download gff for FMO12426.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 78..251 1..176 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:04:01 Download gff for FMO12426.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 78..251 1..176 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:07:43 Download gff for FMO12426.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 78..251 1..176 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:07:43 Download gff for FMO12426.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 14933663..14933835 1..176 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:04:01 Download gff for FMO12426.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 10821168..10821340 1..176 96   Plus