Clone FMO12657 Report

Search the DGRC for FMO12657

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:126
Well:57
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG13616-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12657.5prime Sequence

233 bp (177 high quality bases) assembled on 2013-01-17

> FMO12657.5prime
CAGTCGACATGAGGCTCTCTCGAACTGGCCACTTCAGTTTGCTGGCACTT
TGCCTCCTGCTGCACGAGGTGCAATCCCAGGTGATGTCCATGTCATCAGC
TGCCAACCGGACAGGGGAGGTGACCAAAAGTTTCTGCGCCCGGCACAAGC
GTTTATCTGGCATTTTCCGGAAGGGCTCATCGGGTTTCGGGGCGCCGTTT
TGCATGACGATCGGCATGATTGGGCAATCCCAA

FMO12657.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:30:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG13616-RB 752 CG13616-RB 34..248 8..230 870 95.5 Plus
CG13616-RA 750 CG13616-RA 34..246 8..230 865 95.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:30:30
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 24392922..24393075 8..165 610 96.8 Plus
Blast to na_te.dros performed on 2014-11-28 18:30:31 has no hits.

FMO12657.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-17 11:08:16 Download gff for FMO12657.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13616-RA 6..225 1..231 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:58:01 Download gff for FMO12657.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13616-RA 27..246 1..231 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:19:16 Download gff for FMO12657.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13616-RB 27..248 1..231 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:19:16 Download gff for FMO12657.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 24392915..24393096 1..189 94 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:58:01 Download gff for FMO12657.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 20218637..20218818 1..189 94 -> Plus