Clone FMO12662 Report

Search the DGRC for FMO12662

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:126
Well:62
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG17298-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12662.5prime Sequence

311 bp (311 high quality bases) assembled on 2013-01-17

> FMO12662.5prime
CAGTCGACATGTTCAAAGTACTGTTCGTGCTCGCCGCCTTCGTCGCCTCT
CAGGCTATCGCCCATCCCGGCGTGGTGGCCGTGGCACCCGTGGTGGCGCA
CCCGGCGGTGGTCCACACGCCCATCATCCATCATGGAGCCCACTCGGTGC
ACTCCCATGTTGTTCATCATCCGGCAGCCGTCAAGGTCATCACACCCGTC
GTCCACAAGCCCGTGGTGGCGGTGCATGCTGTCAAGCCGGTGGTTCCATT
GGTTCCAGTGCATCATGCCGCCCCCGCCGTCGTCGTGCATCATGCAAGCT
TTCTAGACCAT

FMO12662.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:22:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG17298-RA 495 CG17298-RA 79..363 9..293 1410 99.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:22:30
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 21283780..21283918 155..293 680 99.3 Plus
3R 32079331 3R 21283584..21283717 21..154 670 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:22:31 has no hits.

FMO12662.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-17 11:07:26 Download gff for FMO12662.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17298-RA 72..367 1..298 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:53:08 Download gff for FMO12662.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17298-RA 72..367 1..298 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:14:59 Download gff for FMO12662.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17298-RA 72..367 1..298 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:14:59 Download gff for FMO12662.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 21283584..21283717 21..154 100 -> Plus
3R 21283780..21283922 155..298 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:53:08 Download gff for FMO12662.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 17109306..17109439 21..154 100 -> Plus
arm_3R 17109502..17109644 155..298 97   Plus