Clone FMO12664 Report

Search the DGRC for FMO12664

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:126
Well:64
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG30192-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12664.5prime Sequence

236 bp (236 high quality bases) assembled on 2013-01-17

> FMO12664.5prime
CAGTCGACATGGCGGATCCGAGTATCAATGACATCGATGAGACTGTGGCT
CCTCCCCTCGGAGGCGCTGACAGCTTCGACCTGAACAAGCGGCTAGATTG
CGAGCATTTAGATCAGATGACGGATAATTGGACCGATTATCAAAGACCCT
CGTTTGCCACCGAACTTCTGCGATTTTTCGGCAACGTATTTGTCGATATA
TTTAATGCGATTTTCAACGCAAGCTTTCTAGACCAT

FMO12664.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:22:39
Subject Length Description Subject Range Query Range Score Percent Strand
CG30192-RA 373 CG30192-RA 86..296 8..218 1055 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:22:37
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 23138674..23138777 8..111 520 100 Plus
2R 25286936 2R 23138842..23138924 110..192 415 100 Plus
Blast to na_te.dros performed 2014-11-28 18:22:38
Subject Length Description Subject Range Query Range Score Percent Strand
3S18 6126 3S18 DM23420 6126bp Derived from U23420 (g733531) (Rel. 48, Last updated, Version 3). 3970..4004 143..177 112 80 Plus

FMO12664.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-17 11:07:27 Download gff for FMO12664.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30192-RA 89..311 1..225 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:53:12 Download gff for FMO12664.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30192-RA 80..302 1..225 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:15:02 Download gff for FMO12664.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30192-RA 80..302 1..225 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:15:02 Download gff for FMO12664.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 23138668..23138777 1..111 96 -> Plus
2R 23138844..23138924 112..192 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:53:12 Download gff for FMO12664.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 19026191..19026300 1..111 96 -> Plus
arm_2R 19026367..19026447 112..192 100 -> Plus