Clone FMO12674 Report

Search the DGRC for FMO12674

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:126
Well:74
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG17193-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12674.5prime Sequence

230 bp (230 high quality bases) assembled on 2013-01-17

> FMO12674.5prime
CAGTCGACATGGCCGGCGGGGGCAGGACAGCCGGCAAATACGGATATTCG
GACAACAATTATTACAGTGGTCACTCGTACAAGAGCATCAACGATGAGAT
TATACTGGTCAGCATCATAATGGGCATCACCATACTGGTCCTCATCACCA
TCGCACTGTGCTACATTGCGTACGAGAAGTGCCAGAAGAAGCGGGAGTAC
TATATCAACGCCGCAAGCTTTCTAGACCAT

FMO12674.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:23:29
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 3568 CG17193-RC 193..396 9..212 1020 100 Plus
CG17193-RB 3915 CG17193-RB 540..743 9..212 1020 100 Plus
CG17193-RA 3918 CG17193-RA 543..746 9..212 1020 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:23:27
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20039593..20039736 212..69 720 100 Minus
3R 32079331 3R 20049647..20049709 71..9 315 100 Minus
X 23542271 X 17422885..17422989 189..85 240 81.9 Minus
Blast to na_te.dros performed on 2014-11-28 18:23:28 has no hits.

FMO12674.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-17 11:07:33 Download gff for FMO12674.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..750 9..220 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:53:42 Download gff for FMO12674.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..750 9..220 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:15:32 Download gff for FMO12674.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 543..754 9..220 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:15:32 Download gff for FMO12674.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 20039585..20039737 64..220 94 -> Minus
3R 20049654..20049709 9..63 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:53:42 Download gff for FMO12674.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15865307..15865459 64..220 94 -> Minus
arm_3R 15875376..15875431 9..63 98   Minus