Clone FMO12682 Report

Search the DGRC for FMO12682

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:126
Well:82
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpL41-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12682.5prime Sequence

101 bp (101 high quality bases) assembled on 2013-01-17

> FMO12682.5prime
CAGTCGACATGAGAGCTAAGTGGCGTAAGAAGCGTATGCGTAGGTTGAAG
CGTAAGCGCAGAAAGATGCGTGCAAGGTCCAAGGCAAGCTTTCTAGACCA
T

FMO12682.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:23:17
Subject Length Description Subject Range Query Range Score Percent Strand
RpL41-RA 320 CG30425-RA 44..118 9..83 375 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:23:15
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 24903726..24903790 83..19 325 100 Minus
Blast to na_te.dros performed on 2014-11-28 18:23:16 has no hits.

FMO12682.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-17 11:07:31 Download gff for FMO12682.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL41-RA 32..117 2..89 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:53:35 Download gff for FMO12682.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL41-RA 38..123 2..89 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:15:24 Download gff for FMO12682.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL41-RA 38..123 2..89 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:15:24 Download gff for FMO12682.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 24903721..24903792 15..89 94   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:53:35 Download gff for FMO12682.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 20791244..20791315 15..89 94   Minus