Clone FMO12717 Report

Search the DGRC for FMO12717

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:127
Well:17
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPP2A-B'-RK
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12717.5prime Sequence

1112 bp (995 high quality bases) assembled on 2013-01-29

> FMO12717.5prime
CAGTCGACATGGATAACGAGGCGTTAGATCCAACAATAAAAAGCAGTACG
TCGGCAGCGACGCCAACAGCAGCAGCATCAGAAACGACAACAACAGCAGC
ATCTTCAGTTGTGGAAACCACAACAACAATCGCGGCGGCCACAGCCTCAG
CGGCAGAATCAAAAAACGAAACAACGGCCACAAACAACAATAGCAACACA
AGCGGCAGCATCAGCAGTAGTAGCAGCAACAATATAGTCATACCGGCATC
GGCCACTAACGGTATCAAAGAGAGTAACAGTAACTTAAGTACAACAACAA
CAGCAGCAGCAGTAGCGGCAGCAACAACTGTAGAAGGAGTAGCTCCAGCA
ATAACGTCCACAATCGTGGTGACCGGCGGCACTCCTCCATTGAGCAGTTT
GGCTAACAAACTCAAGGACAACACACCACCGTACGATGCACCGCCGCCCA
CGCCGATCAGCAAGGTCCTGAACATCACCGGCACCCCGATCGTTCGCAAG
GAGAAGCGCCAGACCAGCGCCCGGTACAATGCCTCCAAGAACTGCGAACT
GACGGCCCTCATTCCGCTAAACGAGAAGACCGCCGCCAGTGAACGTGAGG
AGCTGTTCATACAGAAGATCCAGCAATGCTGCACACTGTTCGACTTCTCC
GAGCCGCTCAGCGACCTCAAGTTCAAGGAGGTGAAGCGGGCGGCTCTGCA
CGAAATGGTCGATTTCCTCACCAACCAAAATGGCGTAATAACCGAAGTTA
TTTACCCGGAGGCGATCAATATGTTTGCTGTCAACCTTTTCCGAACTCTG
CCGCCATCGTCCAACCCGAATGGTGCCGAATTCGATCCGGAGGAGGATGA
GCCCACGTTGGAGTCCTCGTGGCCGCATCTGCAACTCGTTTACGAGCTGT
TCTTGCGCTTCTTGAGTCACCAGATTTTCAACCAGCATGGCAAACGTTTT
ATCGACATCAATTTGTATTACACTATTGATTATCGATTCGGAGATCCACG
TGACGTGATTTCCTGAGACTGTTTACATCGCATTCTATGAAATTTTGGCT
GAGAGCATTAATAGAAGCGATCACATGTCTTTTACGATTATTTATGAACG
AACTCTAATGCC

FMO12717.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:40:22
Subject Length Description Subject Range Query Range Score Percent Strand
PP2A-B'-RO 4402 CG7913-RO 1266..2378 9..1098 4950 97.7 Plus
PP2A-B'-RN 2727 CG7913-RN 567..1679 9..1098 4950 97.7 Plus
PP2A-B'-RM 2280 CG7913-RM 120..1232 9..1098 4950 97.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:40:13
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 18169706..18170099 9..402 1970 100 Plus
3R 32079331 3R 18175333..18175529 577..773 985 100 Plus
3R 32079331 3R 18171528..18171703 401..576 880 100 Plus
3R 32079331 3R 18175602..18175805 773..972 820 98 Plus
Blast to na_te.dros performed 2014-11-28 18:40:18
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2337..2836 31..528 486 59.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6744..7060 39..360 328 60.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6710..7015 28..330 320 60.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6943 115..339 319 63.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2310..2544 55..316 315 63.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2380..2683 39..354 311 61.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6728..6944 88..310 310 63.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2525 148..363 304 63.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2553 91..354 301 60.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6725..6897 64..234 293 64.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6721..6896 178..355 290 65.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2747..3034 57..353 284 60.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2787..3001 31..247 270 60.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..6921 142..350 260 61.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2471 193..363 257 63.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6770..7079 31..349 250 57 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2509 172..381 249 61.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2594..2916 27..364 242 58.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6498..6829 26..354 236 57.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2634..2937 52..343 230 58.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2601..2885 64..363 229 57.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2764..2957 33..232 229 59.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2457..2781 31..355 227 59.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6832..7088 54..310 212 55.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2585..2855 78..351 211 58.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6719..6859 221..363 205 63.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6863 196..355 201 63.1 Plus
roo 9092 roo DM_ROO 9092bp 956..1161 156..362 195 57.6 Plus
roo 9092 roo DM_ROO 9092bp 1061..1159 142..241 191 67 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2323..2408 276..363 183 69.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1516..1587 29..103 178 74.7 Plus
roo 9092 roo DM_ROO 9092bp 1059..1180 71..191 177 63.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1498..1615 160..281 176 65 Plus
roo 9092 roo DM_ROO 9092bp 1073..1161 179..267 174 68.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2318..2432 253..363 169 63.5 Plus
roo 9092 roo DM_ROO 9092bp 1067..1179 52..170 168 62.2 Plus
roo 9092 roo DM_ROO 9092bp 1058..1136 275..355 166 69.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6851..7005 52..198 161 62.7 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 970..1080 293..400 160 64.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6725..6796 292..363 153 68.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2316..2505 292..485 149 55.9 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3268..3335 42..108 148 70.6 Plus
roo 9092 roo DM_ROO 9092bp 1048..1161 15..128 147 62.4 Plus
roo 9092 roo DM_ROO 9092bp 1101..1164 39..104 145 73.1 Plus
roo 9092 roo DM_ROO 9092bp 1072..1154 246..328 144 66.7 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3277..3342 284..349 141 68.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1507..1605 30..126 138 62.6 Plus
roo 9092 roo DM_ROO 9092bp 1013..1104 259..350 136 60.9 Plus
Dmer\R1A3 3772 Dmer\R1A3 MERCR1A3 3772bp 671..722 343..292 134 73.1 Minus
roo 9092 roo DM_ROO 9092bp 1076..1180 31..130 133 63.8 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3254..3394 54..192 133 56 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 972..1019 61..108 132 75 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1521..1589 292..360 129 65.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2359 298..350 121 69.8 Plus
Doc2-element 4789 Doc2-element DOC2 4789bp 549..622 291..361 119 66.2 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 67..196 201..330 118 56.5 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 9097..9226 201..330 118 56.5 Plus
Dyak\TART 8444 Dyak\TART TARTYAK 8444bp 7955..8049 292..387 117 60.8 Plus
TART-C 11124 TART-C TARTC 11124bp 9399..9493 292..387 117 60.8 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 970..1006 198..234 113 78.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1506..1586 252..330 111 63 Plus

FMO12717.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-29 10:43:03 Download gff for FMO12717.5prime
Subject Subject Range Query Range Percent Splice Strand
PP2A-B'-RL 293..1342 9..1046 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:04:22 Download gff for FMO12717.5prime
Subject Subject Range Query Range Percent Splice Strand
PP2A-B'-RM 120..1169 9..1046 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:24:35 Download gff for FMO12717.5prime
Subject Subject Range Query Range Percent Splice Strand
PP2A-B'-RM 120..1169 9..1046 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:24:35 Download gff for FMO12717.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 18169706..18170098 9..401 100 -> Plus
3R 18171529..18171703 402..576 100 -> Plus
3R 18175333..18175529 577..773 100 -> Plus
3R 18175603..18175887 774..1046 94   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:04:22 Download gff for FMO12717.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 13995428..13995820 9..401 100 -> Plus
arm_3R 13997251..13997425 402..576 100 -> Plus
arm_3R 14001055..14001251 577..773 100 -> Plus
arm_3R 14001325..14001609 774..1046 94   Plus