Clone FMO12764 Report

Search the DGRC for FMO12764

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:127
Well:64
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8407-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12764.5prime Sequence

338 bp (338 high quality bases) assembled on 2013-01-29

> FMO12764.5prime
CAGTCGACATGGCAGACGAGGAGGCCGGCAAGGAGGGCGAGAAGAAAATC
GTGCACGTTTATCCTCTGGTTAAGCACACCGATATGAACGAGGAGATGCG
GATAGAGGCCATTGAACTGTCCATTACCGCCTGCGAGAAATACTCATCGA
ACTACGAGCACGCTGCCAAAATCATCAAGGAGAACATGGACAAGAAGTTC
GGCATCTACTGGCATGTGGTCGTGGGCGAAGGGTTCGGCTTTGAGGTCTC
CTACGAGACGGAGAACATTCTTTATCTGTTCTTCGCCGGCAACCTGGCCA
TCGTGCTGTGGAAGTGCTCCGCAAGCTTTCTAGACCAT

FMO12764.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:43:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG8407-RB 728 CG8407-RB 218..532 6..320 1575 100 Plus
CG8407-RA 612 CG8407-RA 102..416 6..320 1575 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:43:07
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12153904..12154067 157..320 820 100 Plus
2R 25286936 2R 12153640..12153728 70..158 445 100 Plus
2R 25286936 2R 12153510..12153578 6..74 345 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:43:07 has no hits.

FMO12764.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-29 10:43:22 Download gff for FMO12764.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8407-RA 98..420 1..324 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:06:17 Download gff for FMO12764.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8407-RA 98..420 1..324 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:26:10 Download gff for FMO12764.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8407-RA 98..420 1..324 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:26:10 Download gff for FMO12764.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12153506..12153578 1..74 95 -> Plus
2R 12153645..12153728 75..158 100 -> Plus
2R 12153906..12154071 159..324 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:06:17 Download gff for FMO12764.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8041011..8041083 1..74 95 -> Plus
arm_2R 8041150..8041233 75..158 100 -> Plus
arm_2R 8041411..8041576 159..324 98   Plus