Clone FMO12779 Report

Search the DGRC for FMO12779

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:127
Well:79
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSfp33A2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO12779.5prime Sequence

176 bp (176 high quality bases) assembled on 2013-01-29

> FMO12779.5prime
CAGTCGACATGCATTTCTATCATTTAAATGCGCTTTGCGTGATTATTTTA
TTAGATTTGACCAACGCGTTGAATCCAAAGGAAGGATCTACTTTTTGTGT
ACCTAACTATAGAGGATGGTGCTGGGATAGCAATGCGAATGTTTGGACCT
ACGGAAGAGCAAGCTTTCTAGACCAT

FMO12779.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:31:26
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp33A2-RA 337 CG42473-RA 16..166 8..158 755 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:31:24
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 11837728..11837878 8..158 755 100 Plus
Blast to na_te.dros performed 2014-11-28 18:31:25
Subject Length Description Subject Range Query Range Score Percent Strand
GATE 8507 GATE DME010298 8507bp Derived from AJ010298 (e1315889) (Rel. 56, Last updated, Version 1). 383..475 104..13 102 58.1 Minus

FMO12779.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-29 10:42:08 Download gff for FMO12779.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp33A2-RA 9..166 1..158 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:58:34 Download gff for FMO12779.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp33A2-RA 9..166 1..158 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:19:45 Download gff for FMO12779.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp33A2-RA 9..166 1..158 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:19:45 Download gff for FMO12779.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 11837721..11837878 1..158 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:58:34 Download gff for FMO12779.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 11837721..11837878 1..158 97   Plus