Clone FMO13088 Report

Search the DGRC for FMO13088

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:130
Well:88
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34186-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13088.5prime Sequence

197 bp (197 high quality bases) assembled on 2013-01-30

> FMO13088.5prime
CAGTCGACATGTCGGAAACTAGCTCCAAGGATAATGTCAAAACGGCAATG
ACCTATATTTGTGGAGAATGCCATCATGAAAACGAAATGCGCCCCAGGGA
TCCGATTCGTTGTCGCGAGTGTGGATATCGTATCATGTACAAAAAGCGCA
CCAAGCGTCTTGTTGTCTTTGATGCCCGTGCAAGCTTTCTAGACCAT

FMO13088.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:32:36
Subject Length Description Subject Range Query Range Score Percent Strand
Rpb12-RA 353 CG34186-RA 80..250 9..179 855 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:32:35
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 15145179..15145273 159..65 475 100 Minus
2R 25286936 2R 15145383..15145440 66..9 290 100 Minus
Blast to na_te.dros performed 2014-11-28 18:32:35
Subject Length Description Subject Range Query Range Score Percent Strand
297 6995 297 DMIS297 6995bp Derived from X03431 (g8146) (Rel. 36, Last updated, Version 2). 2945..2982 82..45 100 73.7 Minus

FMO13088.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-01-30 10:18:10 Download gff for FMO13088.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34186-RA 51..232 1..183 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:00:33 Download gff for FMO13088.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb12-RA 72..253 1..183 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:04:38 Download gff for FMO13088.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb12-RA 72..253 1..183 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:04:38 Download gff for FMO13088.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 15145067..15145090 160..183 91 <- Minus
2R 15145179..15145271 67..159 100 <- Minus
2R 15145383..15145447 1..66 93   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:00:33 Download gff for FMO13088.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 11032572..11032595 160..183 91 <- Minus
arm_2R 11032684..11032776 67..159 100 <- Minus
arm_2R 11032888..11032952 1..66 93   Minus