Clone FMO13110 Report

Search the DGRC for FMO13110

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:131
Well:10
Vector:pMK33-CFH-BD
Associated Gene/TranscriptHSPC300-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13110.5prime Sequence

254 bp (254 high quality bases) assembled on 2013-02-11

> FMO13110.5prime
CAGTCGACATGAGTGGGGCTCACAGAGAGGCGATCCAAAAGCAGATCCAC
CAGGACTGGGCGAACAGGGAGTATATCGAAGTGATAACTGCCAGCATAAA
GAGAATCACCGACTTTCTGAACTCTTTCGATATGTCCTGTCGCTCCCGTC
TGGCGGTGCTGAACGAAAAACTAACGATCCTGGAGCGGCGCATAGACTAT
CTGGAGGCGTGCGTCGCCCAGGGTGAAACATTAACGGCAAGCTTTCTAGA
CCAT

FMO13110.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:37:29
Subject Length Description Subject Range Query Range Score Percent Strand
HSPC300-RB 584 CG30173-RB 56..283 9..236 1140 100 Plus
HSPC300-RA 349 CG30173-RA 56..283 9..236 1140 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:37:27
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 24028614..24028734 129..9 605 100 Minus
2R 25286936 2R 24028018..24028125 236..129 540 100 Minus
Blast to na_te.dros performed on 2014-11-28 18:37:28 has no hits.

FMO13110.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-02-11 10:56:52 Download gff for FMO13110.5prime
Subject Subject Range Query Range Percent Splice Strand
HSPC300-RA 69..304 9..243 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:02:37 Download gff for FMO13110.5prime
Subject Subject Range Query Range Percent Splice Strand
HSPC300-RA 56..291 9..243 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:23:05 Download gff for FMO13110.5prime
Subject Subject Range Query Range Percent Splice Strand
HSPC300-RA 56..291 9..243 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:23:05 Download gff for FMO13110.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 24028010..24028124 130..243 97 <- Minus
2R 24028614..24028734 9..129 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:02:37 Download gff for FMO13110.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 19915533..19915647 130..243 97 <- Minus
arm_2R 19916137..19916257 9..129 100   Minus