Clone FMO13121 Report

Search the DGRC for FMO13121

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:131
Well:21
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15461-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13121.5prime Sequence

200 bp (200 high quality bases) assembled on 2013-02-11

> FMO13121.5prime
CAGTCGACATGGTGGAGAAAACCAAAACACTTCAGCTGCTGCTAATGGCT
CGCGCCGTATTGACGATCATCTATAATGACCACTTCTGCTGGACCTTCAT
AAAGAGCTATGGACTCTTCTCGCTGGCGATTCCGCTGGCCAAGTACTTCG
ATGGCTTCCAAGTGTTGCCCACCGGTGACGTGGCAAGCTTTCTAGACCAT

FMO13121.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:39:35
Subject Length Description Subject Range Query Range Score Percent Strand
CG15461-RA 332 CG15461-RA 106..279 9..182 870 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:39:34
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 20486362..20486535 9..182 870 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:39:34 has no hits.

FMO13121.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-02-11 10:57:13 Download gff for FMO13121.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15461-RA 102..287 5..192 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:03:57 Download gff for FMO13121.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15461-RA 102..287 5..192 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:24:14 Download gff for FMO13121.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15461-RA 102..287 5..192 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:24:14 Download gff for FMO13121.5prime
Subject Subject Range Query Range Percent Splice Strand
X 20486358..20486543 5..192 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:03:57 Download gff for FMO13121.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 20357385..20357570 5..192 96   Plus