Clone FMO13370 Report

Search the DGRC for FMO13370

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:133
Well:70
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34330-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13370.5prime Sequence

170 bp (170 high quality bases) assembled on 2013-02-11

> FMO13370.5prime
CAGTCGACATGTGGTCGAAAATTGCCATCGCCGGAGCCCTGCTCGTGATG
GGTGGCGTCCTGTCCTCCAGCGTGGTGGACAACTTCGCCTACGTGGATCG
CTCGCTGCCGGTGGCCATGCCCAAGGCAAAGGCCTTCCAAGTGAAACAGG
AGGCAAGCTTTCTAGACCAT

FMO13370.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:34:26
Subject Length Description Subject Range Query Range Score Percent Strand
CG34330-RB 699 CG34330-RB 206..350 8..152 725 100 Plus
CG34330-RA 618 CG34330-RA 125..269 8..152 725 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:34:24
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 19068624..19068768 152..8 725 100 Minus
Blast to na_te.dros performed on 2014-11-28 18:34:25 has no hits.

FMO13370.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-02-11 10:56:19 Download gff for FMO13370.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34330-RA 119..269 1..152 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:00:35 Download gff for FMO13370.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34330-RA 119..269 1..152 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:21:21 Download gff for FMO13370.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34330-RA 119..269 1..152 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:21:21 Download gff for FMO13370.5prime
Subject Subject Range Query Range Percent Splice Strand
X 19068624..19068771 1..152 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:00:35 Download gff for FMO13370.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 18962657..18962804 1..152 97   Minus