Clone FMO13372 Report

Search the DGRC for FMO13372

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:133
Well:72
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG33155-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13372.5prime Sequence

206 bp (206 high quality bases) assembled on 2013-02-11

> FMO13372.5prime
CAGTCGACATGGTGAGGAAGCACAAAGGAACACTGGCGGTGATCGAGAAG
ATCTACCAGGATATACCCGCATTCTCCGACATCTTCACCGAGGAGAGCTT
CTACATGTTCGCCTTCTGTTTCGTGTGCGCCACCATTCTGGTGGCCTTCA
TTCTCTCCCGGTTCATCACCATCAAGCCCGTCGATTTCGCAAGCTTTCTA
GACCAT

FMO13372.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:34:37
Subject Length Description Subject Range Query Range Score Percent Strand
CG33155-RD 942 CG33155-RD 695..874 9..188 900 100 Plus
CG33155-RC 829 CG33155-RC 582..761 9..188 900 100 Plus
CG33155-RA 725 CG33155-RA 478..657 9..188 900 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:34:35
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 13955417..13955596 9..188 900 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:34:36 has no hits.

FMO13372.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-02-11 10:56:21 Download gff for FMO13372.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33155-RA 471..662 1..194 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:00:40 Download gff for FMO13372.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33155-RA 471..662 1..194 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:21:28 Download gff for FMO13372.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33155-RA 471..662 1..194 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:21:28 Download gff for FMO13372.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 13955410..13955601 1..194 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:00:40 Download gff for FMO13372.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 9842915..9843106 1..194 96   Plus