Clone FMO13395 Report

Search the DGRC for FMO13395

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:133
Well:95
Vector:pMK33-CFH-BD
Associated Gene/TranscriptskpC-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13395.5prime Sequence

190 bp (190 high quality bases) assembled on 2013-02-11

> FMO13395.5prime
CAGTCGACATGGATGCTCCCACCATCAAGCTTGAGTCCTCGGATGGGATG
ATCTTTTCAACGGAAGTCCGAGCCGCCAAGCTCTCCGAAACCATCAAGAC
CATGTTGGAGGTCTCTGCCGTGGAGAACGACGAGAATGCCATTGTGCCGC
TGCCCAAGGTGAACGCGTTCATCCTATCCAAGATTCTGAC

FMO13395.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:43:46
Subject Length Description Subject Range Query Range Score Percent Strand
SkpC-RA 629 CG11941-RA 67..248 9..190 910 100 Plus
SkpD-RA 656 CG12700-RA 73..254 9..190 820 96.7 Plus
SkpE-RA 713 CG11942-RA 82..260 9..187 520 86 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:43:45
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 19816138..19816319 9..190 910 100 Plus
X 23542271 X 19812801..19812982 9..190 820 96.7 Plus
X 23542271 X 19823821..19823999 187..9 520 86 Minus
X 23542271 X 657113..657258 18..163 235 77.4 Plus
Blast to na_te.dros performed on 2014-11-28 18:43:46 has no hits.

FMO13395.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-02-11 10:58:02 Download gff for FMO13395.5prime
Subject Subject Range Query Range Percent Splice Strand
skpC-RA 1..182 9..190 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:06:41 Download gff for FMO13395.5prime
Subject Subject Range Query Range Percent Splice Strand
skpC-RA 1..182 9..190 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:26:35 Download gff for FMO13395.5prime
Subject Subject Range Query Range Percent Splice Strand
SkpC-RA 67..248 9..190 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:26:35 Download gff for FMO13395.5prime
Subject Subject Range Query Range Percent Splice Strand
X 19816138..19816319 9..190 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:06:41 Download gff for FMO13395.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 19710171..19710352 9..190 100   Plus