Clone FMO13510 Report

Search the DGRC for FMO13510

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:135
Well:10
Vector:pMK33-CFH-BD
Associated Gene/Transcriptmre11-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13510.5prime Sequence

135 bp (135 high quality bases) assembled on 2013-02-11

> FMO13510.5prime
CAGTCGACATGAATGGCACCACGACAGCAGAGCAGGATGCTGACAACGTG
ATTCGCATCCTGGTGGCTACCGACAACCACCTGGGCTATGGCGAAAAAGA
CGCGGTGCGCGGCGAGGACAGTTTCACGGCCTTCG

FMO13510.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:48:58
Subject Length Description Subject Range Query Range Score Percent Strand
mre11-RA 2013 CG16928-RA 90..217 8..135 640 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:48:56
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 11282179..11282306 8..135 640 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:48:57 has no hits.

FMO13510.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-02-11 10:59:55 Download gff for FMO13510.5prime
Subject Subject Range Query Range Percent Splice Strand
mre11-RA 79..214 1..135 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:10:15 Download gff for FMO13510.5prime
Subject Subject Range Query Range Percent Splice Strand
mre11-RA 82..217 1..135 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:29:34 Download gff for FMO13510.5prime
Subject Subject Range Query Range Percent Splice Strand
mre11-RA 82..217 1..135 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:29:34 Download gff for FMO13510.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 11282171..11282306 1..135 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:10:15 Download gff for FMO13510.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 11282171..11282306 1..135 97   Plus