Clone FMO13773 Report

Search the DGRC for FMO13773

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:137
Well:73
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRdh-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13773.5prime Sequence

168 bp (-85 high quality bases) assembled on 2013-08-24

> FMO13773.5prime
TCCGTCGACATGTCCGCCAGCGGTCGTCGCTTCTGTCGCAGCCGTTGCCA
AAGTTGTCATTGTCATCCGTACCAGCAAACGCAGCAGCAAAAGCAGCAGC
AGCAGCAGCAGCAGCAACATCAGGCAGCAGCAGCAGCAGCAACTAGCAAC
GCAAGCTTTCTAGACCAT

FMO13773.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:39:48
Subject Length Description Subject Range Query Range Score Percent Strand
Rdh-RA 440 CG14975-RA 76..216 10..150 705 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:39:46
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3825524..3825664 10..150 705 100 Plus
Blast to na_te.dros performed on 2014-11-28 23:39:47 has no hits.

FMO13773.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-24 18:44:46 Download gff for FMO13773.5prime
Subject Subject Range Query Range Percent Splice Strand
Rdh-RA 71..220 2..156 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:20:52 Download gff for FMO13773.5prime
Subject Subject Range Query Range Percent Splice Strand
Rdh-RA 71..220 2..156 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:20:52 Download gff for FMO13773.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 3825519..3825668 2..156 95   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-24 18:44:46 Download gff for FMO13773.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3825519..3825668 2..156 95   Plus