Clone FMO13934 Report

Search the DGRC for FMO13934

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:139
Well:34
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSfp33A4-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13934.5prime Sequence

177 bp (177 high quality bases) assembled on 2014-01-10

> FMO13934.5prime
TCAGTCGACATGCATTGTTATATTCCTATTGCGTTTTGCTTGTTCGCTCT
TTTGGAATTAACAAACGGGGTGAACGAAAAGGAAAGTTCTACCTATTGTG
TATCCTATTTTAATGGTGTATGCTGGGATAAAAGATTTAATATGTGGCCC
ACGGGAAAGGCAAGCTTTCTAGACCAT

FMO13934.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:00:57
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp33A4-RA 244 CG42604-RA 17..166 10..159 750 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-29 00:00:56
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 11837259..11837408 10..159 750 100 Plus
Blast to na_te.dros performed on 2014-11-29 00:00:57 has no hits.

FMO13934.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-01-10 11:20:13 Download gff for FMO13934.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp33A4-RA 8..166 1..159 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:56:05 Download gff for FMO13934.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp33A4-RA 8..166 1..159 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:56:05 Download gff for FMO13934.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 11837250..11837408 1..159 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2014-01-10 11:20:13 Download gff for FMO13934.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 11837250..11837408 1..159 97   Plus