Clone FMO13962 Report

Search the DGRC for FMO13962

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:139
Well:62
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42666-RE
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO13962.5prime Sequence

596 bp (596 high quality bases) assembled on 2014-01-10

> FMO13962.5prime
TCAGTCGACATGCTGCTGGCGGAAATCGGGCAACAGGAAAACATGCTACC
GCCCCCCTACGTAGCAGCAATCAAGCGAAAGATCGATCCAGAGCAACAGC
AGCAACGCAAGCAGCACAGAAGCAACATCCTCGGATGCAACAAGAGCAGC
AGCATCAACTGCAGCAGCATCAACGGCGACAATCGACACCTTCAGAGGCA
GCAGGGCAAAATGTATTACAACTCCAGTTCACGACCCTTTTGGAGGAAAT
GCAGATCGGCTGCCCCAACGAATCTCATGACCACAATACCCACTAACAAC
GACTTGTGCAACACAGCAGCAGCGGCAACATATGACAAAATGCAGAGTTG
CAACAAAAACAGCAGTAGCCGTATCACCACCACCAACAACAACGTTACTA
CAACTAGCAACATTAGCGGCAACAGCAGCAACAAGCGCTGCCCTCAGAAG
TACACCGGCAACACCCTAGCCGTCAACAGTAACATGCTGGCCTATCAGCA
GCAAGCCACCGCCGGTGGCAAGAACTCCACTCGGAAGAGTCGTCACAACA
ACAACAAGCAAAATCATCATCAGCAACAACAAACAACAGCAGCAGC

FMO13962.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:02:42
Subject Length Description Subject Range Query Range Score Percent Strand
CG42666-RJ 3749 CG42666-RJ 716..1303 8..596 2905 99.7 Plus
CG42666-RE 3629 CG42666-RE 596..1183 8..596 2905 99.7 Plus
CG42666-RF 3806 CG42666-RF 362..626 331..596 1290 99.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-29 00:02:38
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 1825658..1825985 8..335 1625 99.7 Plus
X 23542271 X 1843692..1843955 332..596 1260 99.2 Plus
Blast to na_te.dros performed 2014-11-29 00:02:40
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2832 93..596 342 58.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2334..2658 291..596 336 61.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6790..7076 308..596 280 60.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6713..6921 354..581 251 63.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2563 316..574 246 58.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6730..6997 313..582 245 60.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2526 371..596 242 62.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6511..6951 118..581 240 56.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2452..2970 86..596 229 56.5 Plus
roo 9092 roo DM_ROO 9092bp 1041..1165 338..461 190 62.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6900 421..591 187 61.7 Plus
roo 9092 roo DM_ROO 9092bp 1058..1154 366..462 169 66.3 Plus
roo 9092 roo DM_ROO 9092bp 1061..1163 314..426 153 67.5 Plus
roo 9092 roo DM_ROO 9092bp 1075..1165 308..406 151 69 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1517..1575 380..438 132 73.3 Plus
BS 5142 BS BS 5142bp 2017..2105 350..435 132 62.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1508..1591 351..436 128 64.4 Plus
roo 9092 roo DM_ROO 9092bp 1057..1143 398..484 128 66.7 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 970..1036 400..468 105 65.2 Plus

FMO13962.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-01-10 11:21:13 Download gff for FMO13962.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42666-RE 588..1183 1..596 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:57:10 Download gff for FMO13962.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42666-RE 588..1183 1..596 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:57:10 Download gff for FMO13962.5prime
Subject Subject Range Query Range Percent Splice Strand
X 1825650..1825981 1..331 99 -> Plus
X 1843692..1843945 332..584 98 <- Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2014-01-10 11:21:13 Download gff for FMO13962.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 1719683..1720014 1..331 99 -> Plus
arm_X 1737725..1737978 332..584 98 <- Plus