FMO13962.5prime Sequence
596 bp (596 high quality bases) assembled on 2014-01-10
> FMO13962.5prime
TCAGTCGACATGCTGCTGGCGGAAATCGGGCAACAGGAAAACATGCTACC
GCCCCCCTACGTAGCAGCAATCAAGCGAAAGATCGATCCAGAGCAACAGC
AGCAACGCAAGCAGCACAGAAGCAACATCCTCGGATGCAACAAGAGCAGC
AGCATCAACTGCAGCAGCATCAACGGCGACAATCGACACCTTCAGAGGCA
GCAGGGCAAAATGTATTACAACTCCAGTTCACGACCCTTTTGGAGGAAAT
GCAGATCGGCTGCCCCAACGAATCTCATGACCACAATACCCACTAACAAC
GACTTGTGCAACACAGCAGCAGCGGCAACATATGACAAAATGCAGAGTTG
CAACAAAAACAGCAGTAGCCGTATCACCACCACCAACAACAACGTTACTA
CAACTAGCAACATTAGCGGCAACAGCAGCAACAAGCGCTGCCCTCAGAAG
TACACCGGCAACACCCTAGCCGTCAACAGTAACATGCTGGCCTATCAGCA
GCAAGCCACCGCCGGTGGCAAGAACTCCACTCGGAAGAGTCGTCACAACA
ACAACAAGCAAAATCATCATCAGCAACAACAAACAACAGCAGCAGC
FMO13962.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:02:42
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG42666-RJ | 3749 | CG42666-RJ | 716..1303 | 8..596 | 2905 | 99.7 | Plus |
CG42666-RE | 3629 | CG42666-RE | 596..1183 | 8..596 | 2905 | 99.7 | Plus |
CG42666-RF | 3806 | CG42666-RF | 362..626 | 331..596 | 1290 | 99.2 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-29 00:02:38
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
X | 23542271 | X | 1825658..1825985 | 8..335 | 1625 | 99.7 | Plus |
X | 23542271 | X | 1843692..1843955 | 332..596 | 1260 | 99.2 | Plus |
Blast to na_te.dros performed 2014-11-29 00:02:40
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2306..2832 | 93..596 | 342 | 58.2 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2334..2658 | 291..596 | 336 | 61.2 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6790..7076 | 308..596 | 280 | 60.2 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6713..6921 | 354..581 | 251 | 63.9 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2306..2563 | 316..574 | 246 | 58.6 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6730..6997 | 313..582 | 245 | 60.6 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2306..2526 | 371..596 | 242 | 62.9 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6511..6951 | 118..581 | 240 | 56.2 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2452..2970 | 86..596 | 229 | 56.5 | Plus |
roo | 9092 | roo DM_ROO 9092bp | 1041..1165 | 338..461 | 190 | 62.4 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6720..6900 | 421..591 | 187 | 61.7 | Plus |
roo | 9092 | roo DM_ROO 9092bp | 1058..1154 | 366..462 | 169 | 66.3 | Plus |
roo | 9092 | roo DM_ROO 9092bp | 1061..1163 | 314..426 | 153 | 67.5 | Plus |
roo | 9092 | roo DM_ROO 9092bp | 1075..1165 | 308..406 | 151 | 69 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 1517..1575 | 380..438 | 132 | 73.3 | Plus |
BS | 5142 | BS BS 5142bp | 2017..2105 | 350..435 | 132 | 62.9 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 1508..1591 | 351..436 | 128 | 64.4 | Plus |
roo | 9092 | roo DM_ROO 9092bp | 1057..1143 | 398..484 | 128 | 66.7 | Plus |
gypsy11 | 4428 | gypsy11 GYPSY11 4428bp | 970..1036 | 400..468 | 105 | 65.2 | Plus |
FMO13962.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-01-10 11:21:13 Download gff for
FMO13962.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42666-RE | 588..1183 | 1..596 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:57:10 Download gff for
FMO13962.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG42666-RE | 588..1183 | 1..596 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:57:10 Download gff for
FMO13962.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
X | 1825650..1825981 | 1..331 | 99 | -> | Plus |
X | 1843692..1843945 | 332..584 | 98 | <- | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2014-01-10 11:21:13 Download gff for
FMO13962.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_X | 1719683..1720014 | 1..331 | 99 | -> | Plus |
arm_X | 1737725..1737978 | 332..584 | 98 | <- | Plus |