Clone FMO14112 Report

Search the DGRC for FMO14112

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:141
Well:12
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG43389-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO14112.5prime Sequence

171 bp (171 high quality bases) assembled on 2014-07-11

> FMO14112.5prime
TCAGTCGACATGCGAAACAACCAGGCAGACAACACCCAACGGCAAAAACT
CGGCCTGGAGAGAAAGAGGCAGTGGCAGCGACGCGTCTGGGGGCTTACAA
TGGCGGTCGCAACACTAGTGGCGCTTGTAAATAGAGACATAACGAAAAGG
TATGCAAGCTTTCTAGACCAT

FMO14112.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:21:35
Subject Length Description Subject Range Query Range Score Percent Strand
CG43389-RA 923 CG43389-RA 543..686 10..153 720 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-29 00:21:33
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3248664..3248807 10..153 720 100 Plus
Blast to na_te.dros performed on 2014-11-29 00:21:34 has no hits.

FMO14112.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-07-11 10:36:08 Download gff for FMO14112.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43389-RA 543..689 10..157 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:59:42 Download gff for FMO14112.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43389-RA 543..689 10..157 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:59:42 Download gff for FMO14112.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 3248664..3248810 10..157 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2014-07-11 10:36:08 Download gff for FMO14112.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3248664..3248810 10..157 98   Plus