Clone FMO14246 Report

Search the DGRC for FMO14246

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:142
Well:46
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG43251-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO14246.5prime Sequence

144 bp (-88 high quality bases) assembled on 2014-07-25

> FMO14246.5prime
TCAATCGACATGAAAGTCTTCGGAACTATTCTTATGTTGGCAATTTTAGC
CCTAGATGTGTGCAGTGCATTAAAATGTGTTTTAACTTGTCGTACATCGG
CTGGCGACTACGAAGTCATTGAGATAGCAAGCTTTCTAGACCAT

FMO14246.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:28:58
Subject Length Description Subject Range Query Range Score Percent Strand
CG43251-RA 250 CG43251-RA 34..150 10..126 555 98.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-29 00:28:56
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 20759006..20759092 40..126 405 97.7 Plus
Blast to na_te.dros performed on 2014-11-29 00:28:57 has no hits.

FMO14246.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-07-25 10:11:12 Download gff for FMO14246.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43251-RA 30..156 6..134 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 01:07:22 Download gff for FMO14246.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43251-RA 30..156 6..134 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 01:07:22 Download gff for FMO14246.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 20758912..20758946 6..40 94 -> Plus
3L 20759007..20759098 41..134 94   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2014-07-25 10:11:12 Download gff for FMO14246.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 20752012..20752046 6..40 94 -> Plus
arm_3L 20752107..20752198 41..134 94   Plus