FMO14246.5prime Sequence
144 bp (-88 high quality bases) assembled on 2014-07-25
> FMO14246.5prime
TCAATCGACATGAAAGTCTTCGGAACTATTCTTATGTTGGCAATTTTAGC
CCTAGATGTGTGCAGTGCATTAAAATGTGTTTTAACTTGTCGTACATCGG
CTGGCGACTACGAAGTCATTGAGATAGCAAGCTTTCTAGACCAT
FMO14246.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:28:58
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG43251-RA | 250 | CG43251-RA | 34..150 | 10..126 | 555 | 98.3 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-29 00:28:56
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28110227 | 3L | 20759006..20759092 | 40..126 | 405 | 97.7 | Plus |
Blast to na_te.dros performed on 2014-11-29 00:28:57 has no hits.
FMO14246.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-07-25 10:11:12 Download gff for
FMO14246.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43251-RA | 30..156 | 6..134 | 94 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 01:07:22 Download gff for
FMO14246.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG43251-RA | 30..156 | 6..134 | 94 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 01:07:22 Download gff for
FMO14246.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 20758912..20758946 | 6..40 | 94 | -> | Plus |
3L | 20759007..20759098 | 41..134 | 94 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2014-07-25 10:11:12 Download gff for
FMO14246.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3L | 20752012..20752046 | 6..40 | 94 | -> | Plus |
arm_3L | 20752107..20752198 | 41..134 | 94 | | Plus |