Clone FMO14279 Report

Search the DGRC for FMO14279

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:142
Well:79
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG43188-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO14279.5prime Sequence

159 bp (159 high quality bases) assembled on 2014-07-25

> FMO14279.5prime
TCAGTCGACATGGTGTGGGATACTCAAGAGTGTAGCAATCAAGATGAGGA
TTTTGAACGGCCCAGCAGGACCCTGATTCTGGTAATCTTCACCCTCGCCG
TGTGCCTCAAGTTGTTCATCATTCTGCTGGAGATTATGTCCGCAAGCTTT
CTAGACCAT

FMO14279.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:31:40
Subject Length Description Subject Range Query Range Score Percent Strand
CG43188-RA 795 CG43188-RA 53..184 10..141 660 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-29 00:31:38
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 11085638..11085769 10..141 660 100 Plus
Blast to na_te.dros performed on 2014-11-29 00:31:39 has no hits.

FMO14279.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-07-25 10:12:30 Download gff for FMO14279.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43188-RA 53..184 10..141 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 01:09:22 Download gff for FMO14279.5prime
Subject Subject Range Query Range Percent Splice Strand
CG43188-RA 53..184 10..141 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 01:09:22 Download gff for FMO14279.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 11085638..11085769 10..141 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2014-07-25 10:12:30 Download gff for FMO14279.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 6973143..6973274 10..141 100   Plus