Clone FMO14334 Report

Search the DGRC for FMO14334

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:143
Well:34
Vector:pMK33-CFH-BD
Associated Gene/Transcriptsrp-RG
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO14334.5prime Sequence

952 bp (872 high quality bases) assembled on 2015-04-08

> FMO14334.5prime
TCAGTCGACATGACGAAAACGACAAAGCCCAAGGAGAAGGCAGCGGCGGG
AGGGGCGGTTATAGGGTCGGGATCGGGATTGGGTTCGGTGACCAAGGCGG
GCGGCGGTAGTCTGCTTTCGAATGCGGCGGACAGTAAGATCCGCACGGCC
AAGTCCAACAACAACAAGCGGCAGGCAGGACGAGCGGCGACAGCATTAGC
AGCTACAACAACAGCATCAGCCTTAGCGGCAACAACAACAGCGGGAGCAA
CAGGATCAAATGCAGCAGCGAATGAGACGGAAATAGCGATCGAAACGGAG
AACGGAGAAGCAGCGACGCCGACTGCGGCAGCAACGGCCGCCGCAGCGAA
TTTATCGTCACTTGAGTCCGCTCGCTCGCAGGCTCTCACTTCAGTTGTCA
GCGAAACAGCAAGGCAAGCGGTTACCACAGCAAACGCGTCGGCAACATCA
ACATCAACAGTTACAGCAGCAACAGAAATAGCAACCGCAACAGCAAGCGA
CACAGCAGCAACATCTGAAGCAGCGATCGATGACGATCCAAGTGCGATAA
ATACTAACAATAATAATAATAATAGTAAAGCGCAGAACGACGCGAGTGAA
AGTGTTAAAACAAAAGTGATAAGCTACCATCAGTCTGAGGATCAACAGCA
ACAGCAGCAGCAACAAGCCCATATCTACGAGCAACAGCAACAGTTTCTCA
GCCAGCAATTAATAAGCCACCATCAGCAGGAACAGCATCAGCAGGCGCAG
CAGCAACAGCATCAGCAGGTGGTGCAGGAGCAACACCAGGCCAGTTGGCT
GGCCTATGACCTGACCAGCGGATCAGCGGCAGCAGCAGCGGGCGGCAGCG
GCAGCAGCATCGCATCCCACCTCTTCAGGAAATTTCTCTATCCGCCAGCC
ATCAACGCCTACCAGCTCTCTACGAGACATAACTCAGCACGGATTCCTAA
TG

FMO14334.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2015-04-08 10:05:58
Subject Length Description Subject Range Query Range Score Percent Strand
srp-RA 4459 CG3992-RA 86..1031 9..952 4360 98 Plus
srp-RB 4414 CG3992-RB 86..1031 9..952 4360 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-04-08 10:05:51
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 15994225..15995112 9..896 4240 99 Plus
Blast to na_te.dros performed 2015-04-08 10:05:55
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2283..2956 119..788 453 56.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2334..2992 156..862 438 57.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2266..2945 160..865 414 56.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2268..2656 404..788 350 59.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2366..2989 131..788 337 56.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6743..7111 156..526 336 57.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2439..2999 156..693 323 56.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6721..7090 155..526 318 58 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6531..7217 204..894 310 55 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6723..6941 641..861 298 63.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2384..2856 403..861 273 57.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6532..6885 430..788 268 58.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2362..2524 626..788 266 62.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6783..7036 626..881 266 57.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2312..2659 403..743 263 56.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2341..2501 626..789 263 64 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2456..3034 124..692 257 54.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6750..6918 626..788 255 63.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2323..2535 626..861 253 62.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2496 648..861 250 64.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6766..7446 131..789 241 54.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2365..2552 609..795 235 59.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2352..2814 399..861 234 54.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6719..6860 197..335 234 64.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2769..2963 156..361 221 59.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6719..7079 423..787 220 56.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2718..2934 133..347 216 58.8 Plus
roo 9092 roo DM_ROO 9092bp 1059..1227 405..574 216 63.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2587..2903 177..526 215 58.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6721..6824 415..515 215 71.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6725..6943 464..693 214 60.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6779..6900 399..519 210 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1603 200..285 205 70.9 Plus
roo 9092 roo DM_ROO 9092bp 1064..1157 440..534 201 71.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6723..6949 306..543 200 57.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2787..2979 132..335 198 60.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6713..6924 473..695 195 58.7 Plus
roo 9092 roo DM_ROO 9092bp 1049..1174 180..296 195 65.9 Plus
roo 9092 roo DM_ROO 9092bp 1071..1165 157..250 193 71.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2446..2549 641..743 183 70.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6819..6952 626..765 182 61.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6437..7002 203..767 178 52.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1463..1595 392..519 176 63.7 Plus
roo 9092 roo DM_ROO 9092bp 1046..1136 431..524 175 67 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1521..1673 425..582 173 61.9 Plus
roo 9092 roo DM_ROO 9092bp 904..1163 470..742 160 56.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1482..1588 121..222 153 65.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2923..3000 174..254 146 66.7 Plus
roo 9092 roo DM_ROO 9092bp 1050..1171 378..496 143 59.8 Plus
BS 5142 BS BS 5142bp 2016..2105 680..769 135 61.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1525..1598 641..717 134 69.2 Plus
roo 9092 roo DM_ROO 9092bp 1077..1144 626..693 133 66.2 Plus
Dyak\TART 8444 Dyak\TART TARTYAK 8444bp 7391..7450 189..249 131 70.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1358..1629 423..707 130 57 Plus
Dmer\R1A3 3772 Dmer\R1A3 MERCR1A3 3772bp 670..728 270..212 124 67.8 Minus
roo 9092 roo DM_ROO 9092bp 1109..1182 625..696 121 66.2 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 973..1078 180..284 113 62.7 Plus
TART-A 13424 TART-A 13424bp 93..162 190..261 112 65.8 Plus
TART-A 13424 TART-A 13424bp 11271..11340 190..261 112 65.8 Plus
roo 9092 roo DM_ROO 9092bp 1104..1154 641..691 111 68.6 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3285..3378 643..737 111 62.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1543..1571 638..666 109 86.2 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 128..194 159..221 109 67.2 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 9158..9224 159..221 109 67.2 Plus

FMO14334.5prime Sim4 Records

Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-04-08 10:08:50 Download gff for FMO14334.5prime
Subject Subject Range Query Range Percent Splice Strand
srp-RA 86..964 9..888 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-04-08 10:08:50 Download gff for FMO14334.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 15994225..15995123 9..906 98 <- Plus