Clone GH11908 Report

Search the DGRC for GH11908

Clone and Library Details

Library:GH
Tissue Source:Drosophila melanogaster head
Created by:Ling Hong
Date Registered:1998-06-02
Comments:Sized fractionated cDNAs were directly ligated into pOT2. Plasmid cDNA library.
Original Plate Number:119
Well:8
Vector:pOT2
Associated Gene/TranscriptCG9284-RA
Protein status:GH11908.pep: wuzgold
Preliminary Size:860
Sequenced Size:851

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG9284 2001-01-01 Release 2 assignment
CG9284 2001-09-19 Blastp of sequenced clone
CG9284 2003-01-01 Sim4 clustering to Release 3
CG9284 2008-04-29 Release 5.5 accounting
CG9284 2008-08-15 Release 5.9 accounting
CG9284 2008-12-18 5.12 accounting

Clone Sequence Records

GH11908.complete Sequence

851 bp (851 high quality bases) assembled on 2001-09-19

GenBank Submission: AY060278

> GH11908.complete
ATTCCGAGCACCAGACCTAAATGGGATAGTTTTGTTTTCCGGCTTTTTTG
TTTTTCGGTGTGAGTTTGTGAGCTTGTAACCGTTCGAAATTTTGTGCTTT
AAGTTTTTGTTGGACAAGTCGCTGCCATGTTTCACCATGAATTCGAACGA
GATCAGTGCATCATCGAGGAATACCAAAGACGCCCCAAAAACGATGTCCT
CCAATGGTAGTGGTGCGGTGGACGGCGTAAGTCCTTGTCATCTGGCCGCA
ACTGCGGTTGTTTCCACTGCCAGAGGAGGCGTCAGAGAAACGAGCAGAGG
ACATAAGGCTATCCGTGTATTTTTGGATCACCACGGTGGTTAGGAAATCG
CGTTGCTCTAAAACTCGCTAATCCTGGCCACTGCAAAAATTAACTTTTCG
ATGAACACATTTTTGGGAGCTATTATTGGATTCAGATTATAATAGCTCTC
ATATGCTGGGATACCCAACACTGGGATATCCTACACTGGGTAACCTATAC
TTTGGTACCCTATACCTTGGTACCCTATAATTTGGTACCCTATAGTTGGA
TACCCTTCACTTGGATGCCCTACACTTGGATACCATACACTTGGATACCC
TACCCTTGGATACCCTACCCTTGGATACCCCAAAGCTTGGATACCCCAAA
GCTTGGATACCCCAAATATGGATAACGATTGACTAGGATTCGAAATATAT
AGGATAGGTTTCTAGGATTAACTTGGATACCCCATATTTGACTGTTATTA
GGACGGCTGTTCCCAAACTCAAGAATGAATAGATTATTTAAAACGTCAAT
CTACGTTGATTAATTAAAGACTTTAATAAGCGTCAAAAAAAAAAAAAAAA
A

GH11908.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 20:59:18
Subject Length Description Subject Range Query Range Score Percent Strand
CG9284-RA 995 CG9284-RA 65..901 1..837 4185 100 Plus
CG9284-RB 897 CG9284-RB 177..896 118..837 3600 100 Plus
CG9284-RB 897 CG9284-RB 53..169 1..117 585 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 00:30:10
Subject Length Description Subject Range Query Range Score Percent Strand
chr2R 21145070 chr2R 17690058..17690774 118..834 3585 100 Plus
chr2R 21145070 chr2R 17689886..17690004 1..119 580 99.2 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 16:45:22 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 00:30:09
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21803622..21804341 118..837 3600 100 Plus
2R 25286936 2R 21803450..21803568 1..119 595 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:18:06
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25260384 2R 21804821..21805540 118..837 3600 100 Plus
2R 25260384 2R 21804649..21804767 1..119 595 100 Plus
Blast to na_te.dros performed on 2019-03-16 00:30:09 has no hits.

GH11908.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 00:31:15 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
chr2R 17689886..17690002 1..117 99 -> Plus
chr2R 17690058..17690774 118..834 100   Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 16:36:31 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RB 1..207 137..343 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 20:58:45 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RB 1..207 137..343 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 21:41:57 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RB 1..207 137..343 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 01:13:25 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RA 27..860 1..834 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 20:58:45 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RA 27..860 1..834 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 21:41:58 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RA 27..860 1..834 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:31:15 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21803450..21803566 1..117 100 -> Plus
2R 21803622..21804338 118..834 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:31:15 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21803450..21803566 1..117 100 -> Plus
2R 21803622..21804338 118..834 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 00:31:15 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21803450..21803566 1..117 100 -> Plus
2R 21803622..21804338 118..834 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:51:00 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17690955..17691071 1..117 100 -> Plus
arm_2R 17691127..17691843 118..834 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:51:00 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17690955..17691071 1..117 100 -> Plus
arm_2R 17691127..17691843 118..834 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:51:00 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17690955..17691071 1..117 100 -> Plus
arm_2R 17691127..17691843 118..834 100   Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 18:25:11 Download gff for GH11908.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21804821..21805537 118..834 100   Plus
2R 21804649..21804765 1..117 100 -> Plus

GH11908.pep Sequence

Translation from 136 to 342

> GH11908.pep
MNSNEISASSRNTKDAPKTMSSNGSGAVDGVSPCHLAATAVVSTARGGVR
ETSRGHKAIRVFLDHHGG*
Sequence GH11908.pep has no blast hits.

GH11908.hyp Sequence

Translation from 136 to 342

> GH11908.hyp
MNSNEISASSRNTKDAPKTMSSNGSGAVDGVSPCHLAATAVVSTARGGVR
ETSRGHKAIRVFLDHHGG*
Sequence GH11908.hyp has no blast hits.