Clone GH18460 Report

Search the DGRC for GH18460

Clone and Library Details

Library:GH
Tissue Source:Drosophila melanogaster head
Created by:Ling Hong
Date Registered:1998-06-02
Comments:Sized fractionated cDNAs were directly ligated into pOT2. Plasmid cDNA library.
Original Plate Number:184
Well:60
Vector:pOT2
Associated Gene/TranscriptMtnA-RA
Protein status:GH18460.pep: gold
Sequenced Size:403

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG9470 2002-11-11 Blastp of sequenced clone
MtnA 2008-04-29 Release 5.5 accounting
MtnA 2008-08-15 Release 5.9 accounting
MtnA 2008-12-18 5.12 accounting

Clone Sequence Records

GH18460.complete Sequence

403 bp (403 high quality bases) assembled on 2002-11-11

GenBank Submission: BT001431

> GH18460.complete
TACAATGGTATGCGTAGAAGTGTTTGGCGTAAGCCTGCATGGAGCTGCCA
TTGGTACAGATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCTCAG
TGCAACTAAAGGCCTAAATAGCCCATACCTACCTTTTTTGTAAACAAGTG
AACAAGTTCGAGGAAATACAACTCAATCAAGATGCCTTGCCCATGCGGAA
GCGGATGCAAATGCGCCAGCCAGGCCACCAAGGGATCCTGCAACTGCGGA
TCTGACTGCAAGTGCGGCGGCGACAAGAAATCCGCCTGCGGCTGCTCCGA
GTGAGCTTTCCCCCAAAAAAGATCTGGAGTAGAGGCGCTGCATCTTGTCT
CTCTACACACCCTGCAATAAATGTCCAATTAAAGTAAAAAAAAAAAAAAA
AAA

GH18460.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 20:53:12
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA.d 845 MtnA.d 117..444 60..387 1640 100 Plus
MtnA.c 850 MtnA.c 117..444 60..387 1640 100 Plus
MtnA.b 877 MtnA.b 117..444 60..387 1640 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 10:37:28
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 5609614..5609796 385..203 915 100 Minus
chr3R 27901430 chr3R 5610059..5610203 204..60 725 100 Minus
chrU 10048995 chrU 8595959..8596020 1..62 310 100 Plus
chrU 10048995 chrU 8839349..8839410 62..1 310 100 Minus
chrU 10048995 chrU 8962331..8962392 62..1 310 100 Minus
chrU 10048995 chrU 3651688..3651749 62..1 295 98.4 Minus
chrU 10048995 chrU 6633979..6634040 1..62 295 98.4 Plus
chrU 10048995 chrU 10047343..10047404 1..62 295 98.4 Plus
chrXHet 204175 chrXHet 194937..194998 1..62 295 98.4 Plus
chrU 10048995 chrU 9805333..9805394 1..62 265 95.2 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed 2010-04-22 16:58:01
Subject Length Description Subject Range Query Range Score Percent Strand
CR40766-RA 838 CR40766-RA 112..173 1..62 310 100 Plus
CR41540-RA 1279 CR41540-RA 817..878 1..62 310 100 Plus
CR40596-RA 1001 CR40596-RA 450..511 1..62 295 98.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 10:37:26
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9783776..9783960 387..203 925 100 Minus
3R 32079331 3R 9784223..9784367 204..60 725 100 Minus
rDNA 76973 rDNA 48391..48452 1..62 310 100 Plus
rDNA 76973 rDNA 72572..72633 1..62 310 100 Plus
XYmm 216041 XYmm 165510..165571 1..62 310 100 Plus
Xmm 1049845 Xmm 464574..464635 62..1 310 100 Minus
rDNA 76973 rDNA 18552..18613 1..62 295 98.4 Plus
U 3151297 U 2994278..2994339 1..62 295 98.4 Plus
X 23542271 X 23216056..23216117 1..62 295 98.4 Plus
X 23542271 X 23278357..23278418 62..1 295 98.4 Minus
X 23542271 X 23441444..23441505 1..62 295 98.4 Plus
X 23542271 X 23535973..23536034 62..1 295 98.4 Minus
U 3151297 U 2481575..2481636 1..62 265 95.2 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:12:35
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 9524607..9524791 387..203 925 100 Minus
3R 31820162 3R 9525054..9525198 204..60 725 100 Minus
X 23527363 X 23426536..23426597 1..62 295 98.3 Plus
X 23527363 X 23201148..23201209 1..62 295 98.3 Plus
X 23527363 X 23521065..23521126 62..1 295 98.3 Minus
X 23527363 X 23263449..23263510 62..1 295 98.3 Minus
Blast to na_te.dros performed on 2019-03-16 10:37:26 has no hits.

GH18460.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 10:38:04 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 5609614..5609795 204..385 100 <- Minus
chr3R 5610060..5610207 54..203 98   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 16:48:04 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 1..123 182..304 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 20:49:57 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 1..123 182..304 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 10:44:34 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 1..123 182..304 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 21:32:05 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 1..123 182..304 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 10:13:32 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 1..123 182..304 100   Plus
Sim4 to dmel-all-all_noncoding-r5.12.fasta performed 2010-04-22 16:58:02 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
CR41540-RA 817..895 1..81 93   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-05-27 15:32:50 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 3..330 59..385 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 20:49:57 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 3..330 59..385 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 10:44:34 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 2..329 59..385 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 21:32:06 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 3..330 59..385 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 10:13:32 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 2..329 59..385 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 10:38:04 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
3R 9783778..9783959 204..385 100 <- Minus
3R 9784224..9784371 54..203 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 10:38:04 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
3R 9783778..9783959 204..385 100 <- Minus
3R 9784224..9784371 54..203 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 10:38:04 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
3R 9783778..9783959 204..385 100 <- Minus
3R 9784224..9784371 54..203 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 10:44:34 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5609500..5609681 204..385 100 <- Minus
arm_3R 5609946..5610093 54..203 98   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 18:11:47 Download gff for GH18460.complete
Subject Subject Range Query Range Percent Splice Strand
3R 9524609..9524790 204..385 100 <- Minus
3R 9525055..9525202 54..203 98   Minus

GH18460.hyp Sequence

Translation from 181 to 303

> GH18460.hyp
MPCPCGSGCKCASQATKGSCNCGSDCKCGGDKKSACGCSE*

GH18460.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 09:58:15
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-PB 40 CG9470-PB 1..40 1..40 245 100 Plus
MtnA-PA 40 CG9470-PA 1..40 1..40 245 100 Plus

GH18460.pep Sequence

Translation from 181 to 303

> GH18460.pep
MPCPCGSGCKCASQATKGSCNCGSDCKCGGDKKSACGCSE*

GH18460.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 22:54:04
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\MtnA-PA 40 GF17152-PA 1..40 1..40 172 95 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 22:54:04
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\MtnA-PA 40 GG17325-PA 1..40 1..40 171 95 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:44:36
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-PB 40 CG9470-PB 1..40 1..40 245 100 Plus
MtnA-PA 40 CG9470-PA 1..40 1..40 245 100 Plus
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-16 22:54:05
Subject Length Description Subject Range Query Range Score Percent Strand
Dmoj\GI24880-PA 40 GI24880-PA 1..40 1..40 151 85 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 22:54:05
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL23229-PA 40 GL23229-PA 1..40 1..40 149 77.5 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 22:54:06
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\MtnA-PA 40 GA21812-PA 1..40 1..40 149 77.5 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 22:54:06
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\MtnA-PA 40 GM26211-PA 1..40 1..40 169 95 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 22:54:07
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\MtnA-PA 40 GD20757-PA 1..40 1..40 175 97.5 Plus
Blast to dvir-all-translation-r1.2.fasta performed 2019-03-16 22:54:07
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\MtnA-PA 41 GJ24522-PA 1..39 1..39 153 84.6 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2019-03-16 22:54:07
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK11122-PA 41 GK11122-PA 1..39 1..39 154 87.2 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 22:54:08
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\MtnA-PA 40 GE24728-PA 1..40 1..40 170 92.5 Plus