Clone GH22658 Report

Search the DGRC for GH22658

Clone and Library Details

Library:GH
Tissue Source:Drosophila melanogaster head
Created by:Ling Hong
Date Registered:1998-06-02
Comments:Sized fractionated cDNAs were directly ligated into pOT2. Plasmid cDNA library.
Original Plate Number:226
Well:58
Vector:pOT2
Associated Gene/TranscriptCG17376-RB
Protein status:GH22658.pep: gold
Sequenced Size:472

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG17376 2003-01-01 Sim4 clustering to Release 3
CG17376 2004-01-31 Blastp of sequenced clone
CG17376 2008-04-29 Release 5.5 accounting
CG17376 2008-08-15 Release 5.9 accounting
CG17376 2008-12-18 5.12 accounting

Clone Sequence Records

GH22658.complete Sequence

472 bp (472 high quality bases) assembled on 2004-01-31

GenBank Submission: BT011549

> GH22658.complete
TCGCTTCGACTTCTAAATTTTTTTCTAAATTCCAAATTTACTTTTTCGAT
AATAACTCAACCAAAAAACGTTAGACAAACTCAACATGTGCAACGGATGT
GGATGCTGTGGACCCTGTAATGAAACACCCTGCTGTGGCCCCCACAGTCC
GCCATGCGGAGCCCCGTCTCCCATCCCGTGCTCTCCTGCTCCGGGCATGT
GCTGTCCCCCTCTGCCCGAGGGCGGCATTCCCGATCCCCGTGTCTGGAAC
TACTACAACACGCCCCCAACTTATCCATGTGGCTTCTAAGCGGCTCTGTT
ACTACGGACGACCCATATAAGCGGCGGAACTGAGAACCGTTGGACCATGT
TGTGTAACACGTTTTGGTTAGCAACTCGATCGGATGCATCTATCACCAAT
ATGCAGATTTTTAGGCTTTAAATATTAATAAATATAAGAAATCGAAAAAA
AAAAAAAAAAAAAAAAAAAAAA

GH22658.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 18:06:05
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-RB 547 CG17376-RB 99..544 1..446 2230 100 Plus
CG17376-RA 538 CG17376-RA 367..535 278..446 845 100 Plus
CG17376.a 388 CG17376.a 222..388 278..444 835 100 Plus
CG17376-RA 538 CG17376-RA 99..214 1..116 580 100 Plus
CG17376.a 388 CG17376.a 22..69 69..116 240 100 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 10:12:44
Subject Length Description Subject Range Query Range Score Percent Strand
chr2L 23010047 chr2L 6799538..6799749 280..69 1030 99.1 Minus
chr2L 23010047 chr2L 6798997..6799162 444..279 800 98.8 Minus
chr2L 23010047 chr2L 6801107..6801235 259..131 420 88.4 Minus
chr2L 23010047 chr2L 6799804..6799871 68..1 325 98.5 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 17:03:10 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 10:12:42
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6800487..6800698 280..69 1060 100 Minus
2L 23513712 2L 6799944..6800111 446..279 840 100 Minus
2L 23513712 2L 6802059..6802187 259..131 420 88.4 Minus
2L 23513712 2L 6800753..6800820 68..1 340 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 19:52:43
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6800487..6800698 280..69 1060 100 Minus
2L 23513712 2L 6799944..6800111 446..279 840 100 Minus
2L 23513712 2L 6802059..6802187 259..131 420 88.3 Minus
2L 23513712 2L 6800753..6800820 68..1 340 100 Minus
2L 23513712 2L 6802209..6802251 157..115 140 88.3 Minus
Blast to na_te.dros performed 2019-03-16 10:12:43
Subject Length Description Subject Range Query Range Score Percent Strand
diver 6112 diver Tinker 6112bp 1324..1358 69..35 103 77.1 Minus

GH22658.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 10:14:00 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
chr2L 6799027..6799162 279..414 98 <- Minus
chr2L 6799540..6799749 69..278 99 <- Minus
chr2L 6799804..6799871 1..68 98   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 16:52:37 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 1..204 86..289 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 16:40:54 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 1..204 86..289 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 09:57:23 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 1..204 86..289 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 17:29:46 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 1..204 86..289 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 10:00:00 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 1..204 86..289 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 19:50:02 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 15..458 1..444 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 16:40:54 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 15..458 1..444 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 09:57:23 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 15..458 1..444 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 17:29:46 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 15..458 1..444 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 10:00:00 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 75..518 1..444 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 10:14:00 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6800753..6800820 1..68 100   Minus
2L 6799946..6800111 279..444 100 <- Minus
2L 6800489..6800698 69..278 100 <- Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 10:14:00 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6800753..6800820 1..68 100   Minus
2L 6799946..6800111 279..444 100 <- Minus
2L 6800489..6800698 69..278 100 <- Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 10:14:00 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6800753..6800820 1..68 100   Minus
2L 6799946..6800111 279..444 100 <- Minus
2L 6800489..6800698 69..278 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 09:57:23 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 6799946..6800111 279..444 100 <- Minus
arm_2L 6800489..6800698 69..278 100 <- Minus
arm_2L 6800753..6800820 1..68 100   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 14:02:09 Download gff for GH22658.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6800489..6800698 69..278 100 <- Minus
2L 6800753..6800820 1..68 100   Minus
2L 6799946..6800111 279..444 100 <- Minus

GH22658.hyp Sequence

Translation from 85 to 288

> GH22658.hyp
MCNGCGCCGPCNETPCCGPHSPPCGAPSPIPCSPAPGMCCPPLPEGGIPD
PRVWNYYNTPPTYPCGF*

GH22658.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 11:47:10
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-PB 67 CG17376-PB 1..67 1..67 440 100 Plus
CG17376-PC 91 CG17376-PC 1..65 1..65 428 100 Plus
CG17377-PD 181 CG17377-PD 109..180 2..66 336 76.4 Plus
CG17377-PE 207 CG17377-PE 109..179 2..65 330 76.1 Plus

GH22658.pep Sequence

Translation from 85 to 288

> GH22658.pep
MCNGCGCCGPCNETPCCGPHSPPCGAPSPIPCSPAPGMCCPPLPEGGIPD
PRVWNYYNTPPTYPCGF*

GH22658.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-15 19:37:23
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF14477-PA 160 GF14477-PA 104..160 11..67 268 94.7 Plus
Dana\GF15428-PA 92 GF15428-PA 13..65 12..64 243 94.3 Plus
Blast to dgri-all-translation-r1.3.fasta performed 2019-03-15 19:37:24
Subject Length Description Subject Range Query Range Score Percent Strand
Dgri\GH17231-PA 104 GH17231-PA 22..77 12..67 233 85.7 Plus
Dgri\GH13171-PA 134 GH13171-PA 81..128 20..67 211 87.5 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:13:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-PB 67 CG17376-PB 1..67 1..67 440 100 Plus
CG17376-PC 91 CG17376-PC 1..65 1..65 428 100 Plus
CG17377-PD 181 CG17377-PD 109..180 2..66 336 76.4 Plus
CG17377-PE 207 CG17377-PE 109..179 2..65 330 76.1 Plus
Blast to dmoj-all-translation-r1.3.fasta performed 2019-03-15 19:37:24
Subject Length Description Subject Range Query Range Score Percent Strand
Dmoj\GI17750-PA 80 GI17750-PA 21..76 12..67 232 87.5 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-15 19:37:25
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL26098-PA 187 GL26098-PA 140..187 20..67 222 89.6 Plus
Dper\GL26091-PA 71 GL26091-PA 24..71 20..67 209 91.7 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-15 19:37:25
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA25280-PA 74 GA25280-PA 27..74 20..67 209 91.7 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-15 19:37:26
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM13804-PA 195 GM13804-PA 110..163 12..65 240 90.7 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 19:37:26
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD22537-PA 468 GD22537-PA 383..436 12..65 255 92.6 Plus
Blast to dvir-all-translation-r1.2.fasta performed 2019-03-15 19:37:27
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\GJ17578-PA 86 GJ17578-PA 22..77 12..67 233 87.5 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2019-03-15 19:37:27
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK24788-PA 306 GK24788-PA 215..270 9..64 244 87.5 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 19:37:28
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE18400-PA 197 GE18400-PA 125..164 26..65 174 90 Plus